ID: 1147072989

View in Genome Browser
Species Human (GRCh38)
Location 17:37974509-37974531
Sequence CTCTCCTAAGAGGAGTGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147072989_1147072993 6 Left 1147072989 17:37974509-37974531 CCTGCACACTCCTCTTAGGAGAG No data
Right 1147072993 17:37974538-37974560 AGATGGAGAAATTGCAGTTCAGG No data
1147072989_1147072994 10 Left 1147072989 17:37974509-37974531 CCTGCACACTCCTCTTAGGAGAG No data
Right 1147072994 17:37974542-37974564 GGAGAAATTGCAGTTCAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147072989 Original CRISPR CTCTCCTAAGAGGAGTGTGC AGG (reversed) Intergenic
No off target data available for this crispr