ID: 1147072993

View in Genome Browser
Species Human (GRCh38)
Location 17:37974538-37974560
Sequence AGATGGAGAAATTGCAGTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147072991_1147072993 -4 Left 1147072991 17:37974519-37974541 CCTCTTAGGAGAGAGGCTCAGAT No data
Right 1147072993 17:37974538-37974560 AGATGGAGAAATTGCAGTTCAGG No data
1147072988_1147072993 7 Left 1147072988 17:37974508-37974530 CCCTGCACACTCCTCTTAGGAGA No data
Right 1147072993 17:37974538-37974560 AGATGGAGAAATTGCAGTTCAGG No data
1147072985_1147072993 25 Left 1147072985 17:37974490-37974512 CCCATATGGGCTAAGTGACCCTG No data
Right 1147072993 17:37974538-37974560 AGATGGAGAAATTGCAGTTCAGG No data
1147072989_1147072993 6 Left 1147072989 17:37974509-37974531 CCTGCACACTCCTCTTAGGAGAG No data
Right 1147072993 17:37974538-37974560 AGATGGAGAAATTGCAGTTCAGG No data
1147072986_1147072993 24 Left 1147072986 17:37974491-37974513 CCATATGGGCTAAGTGACCCTGC No data
Right 1147072993 17:37974538-37974560 AGATGGAGAAATTGCAGTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147072993 Original CRISPR AGATGGAGAAATTGCAGTTC AGG Intergenic
No off target data available for this crispr