ID: 1147073664

View in Genome Browser
Species Human (GRCh38)
Location 17:37978616-37978638
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 13, 1: 1, 2: 0, 3: 7, 4: 122}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147073664_1147073672 -2 Left 1147073664 17:37978616-37978638 CCCGCTCCGCAGGGTGTTCAGCC 0: 13
1: 1
2: 0
3: 7
4: 122
Right 1147073672 17:37978637-37978659 CCTGCCAGCAGGGGGCCAGCTGG 0: 12
1: 3
2: 4
3: 38
4: 468
1147073664_1147073675 8 Left 1147073664 17:37978616-37978638 CCCGCTCCGCAGGGTGTTCAGCC 0: 13
1: 1
2: 0
3: 7
4: 122
Right 1147073675 17:37978647-37978669 GGGGGCCAGCTGGTCCTCCTGGG 0: 12
1: 2
2: 5
3: 46
4: 359
1147073664_1147073670 -10 Left 1147073664 17:37978616-37978638 CCCGCTCCGCAGGGTGTTCAGCC 0: 13
1: 1
2: 0
3: 7
4: 122
Right 1147073670 17:37978629-37978651 GTGTTCAGCCTGCCAGCAGGGGG 0: 14
1: 1
2: 4
3: 25
4: 202
1147073664_1147073677 14 Left 1147073664 17:37978616-37978638 CCCGCTCCGCAGGGTGTTCAGCC 0: 13
1: 1
2: 0
3: 7
4: 122
Right 1147073677 17:37978653-37978675 CAGCTGGTCCTCCTGGGATATGG 0: 13
1: 3
2: 3
3: 25
4: 229
1147073664_1147073674 7 Left 1147073664 17:37978616-37978638 CCCGCTCCGCAGGGTGTTCAGCC 0: 13
1: 1
2: 0
3: 7
4: 122
Right 1147073674 17:37978646-37978668 AGGGGGCCAGCTGGTCCTCCTGG 0: 12
1: 2
2: 6
3: 24
4: 328
1147073664_1147073678 19 Left 1147073664 17:37978616-37978638 CCCGCTCCGCAGGGTGTTCAGCC 0: 13
1: 1
2: 0
3: 7
4: 122
Right 1147073678 17:37978658-37978680 GGTCCTCCTGGGATATGGCACGG 0: 15
1: 0
2: 0
3: 14
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147073664 Original CRISPR GGCTGAACACCCTGCGGAGC GGG (reversed) Intronic
900396459 1:2455092-2455114 TGCTGAGCCCCCAGCGGAGCCGG + Intronic
900832293 1:4973811-4973833 GGGTCAGCACCCTGTGGAGCAGG - Intergenic
902369203 1:15994730-15994752 GGCTGGTCACACTGCGGAGGGGG + Intergenic
902644904 1:17791240-17791262 GGCTGTACACTCCGTGGAGCTGG - Intronic
902706750 1:18210689-18210711 TGCTAAACACCCTGCAGTGCGGG - Intronic
905397276 1:37674799-37674821 GGCTGAGCCCCTTGCTGAGCTGG + Intergenic
906298530 1:44664035-44664057 GCCTCAGCACCCTGAGGAGCTGG - Intronic
906662529 1:47593223-47593245 CGCTGCAGACCCTGCGGAGACGG - Intergenic
907369783 1:53993188-53993210 GGCTGCACACTCTGTGAAGCCGG - Intergenic
907491349 1:54810806-54810828 GGCTGAATGCCTTGCGGGGCAGG - Intronic
907603521 1:55793800-55793822 GGATGCACACTCTGTGGAGCTGG + Intergenic
912722747 1:112033874-112033896 GGCTGGACACCCAGGAGAGCTGG + Intergenic
913214579 1:116609880-116609902 GGCTGGAGAGCCTGAGGAGCGGG - Intronic
917520415 1:175743537-175743559 GGCTCAACACCCAGAGGAGACGG - Exonic
917848937 1:179043459-179043481 GGCTGCACACTCCACGGAGCTGG - Intronic
918072435 1:181142686-181142708 GCCTCCACACCCAGCGGAGCGGG - Intergenic
919753652 1:201053507-201053529 GGCTGATCAAGCTGCTGAGCCGG - Exonic
1066659899 10:37728641-37728663 GGCTGCACACCTTGGGGAACAGG - Intergenic
1076648794 10:131972824-131972846 GGCTGGACACTCAGCTGAGCGGG - Intronic
1078141225 11:8694403-8694425 GGCTGAGCACCCTGCAGGGAGGG + Intronic
1080896067 11:36449609-36449631 GGCTGCACACCCTGCCTGGCTGG - Intronic
1081716318 11:45252843-45252865 GGCTGACCACCCTGGGCACCAGG + Intronic
1084105021 11:66975452-66975474 GGCTTAGCGCCCTGCGGAGTTGG - Exonic
1089479119 11:118791071-118791093 GGCTGGACAGCCGGGGGAGCCGG - Intronic
1093183165 12:15989210-15989232 GGCTGCACACTCCGTGGAGCTGG - Intronic
1093525852 12:20102665-20102687 GGCTGCATGCCCTGTGGAGCTGG - Intergenic
1093891224 12:24524247-24524269 AGCTGAAGACCCTGAGGTGCTGG - Intergenic
1096411445 12:51379635-51379657 GGCTGAAGTCCCTGGTGAGCCGG - Exonic
1098308263 12:69123015-69123037 GGCTGAGCAGCCTGCTGCGCTGG + Intergenic
1101737827 12:107476165-107476187 GGCTGAACAGCCTAGGTAGCCGG - Intronic
1104034931 12:125091591-125091613 GGCTGAATTCCCAGGGGAGCCGG + Intronic
1105424324 13:20282283-20282305 GGCTGCACACTCTATGGAGCTGG + Intergenic
1111911169 13:94313517-94313539 GGCTGTATACCCTGGGGAGAAGG + Intronic
1115310712 14:31975213-31975235 GGCTGTACACTCTGTGGAGCCGG - Intergenic
1115327248 14:32153815-32153837 GGCTCAACACTTTGGGGAGCTGG + Intronic
1122265570 14:100545127-100545149 GGCCGCACAGCCTGCTGAGCAGG + Intronic
1123422751 15:20145177-20145199 GGCTGCACTCCTTGGGGAGCAGG + Intergenic
1123531975 15:21151717-21151739 GGCTGCACTCCTTGGGGAGCAGG + Intergenic
1129796628 15:78382346-78382368 GGCTGCACACTCCGTGGAGCTGG + Intergenic
1130283402 15:82536514-82536536 GGCTGAAGACCCAGGGAAGCAGG + Intergenic
1132305202 15:100807230-100807252 GGCTGCACACTCCGTGGAGCTGG + Intergenic
1132585359 16:703813-703835 AGCTGGACACCCTGGGGAGTGGG + Intronic
1133046694 16:3092130-3092152 GGCTGCCCAGCCTGCTGAGCCGG - Exonic
1136080058 16:27846322-27846344 GGGTCAACACCCTTCTGAGCAGG - Intronic
1138454410 16:57113070-57113092 GGCTGGACAGCTTGTGGAGCAGG - Intronic
1138512768 16:57518241-57518263 GGCCGAAAACGCTGCGGAGTGGG - Exonic
1144787484 17:17840142-17840164 GGCTGGAGACCCAGGGGAGCCGG + Intergenic
1146763866 17:35501287-35501309 GGCTGAACACCAGGAGGAACTGG + Intronic
1146842568 17:36166141-36166163 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146854880 17:36254100-36254122 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146865740 17:36334276-36334298 GGCTGAACACCCTGCGGAGCGGG + Exonic
1146870780 17:36377992-36378014 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146878139 17:36429073-36429095 GCCTGAACACCCTGCGGAGCGGG - Exonic
1146882088 17:36450220-36450242 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1147068610 17:37934888-37934910 GGCTGAACACCCTGCGGAGCGGG + Exonic
1147073664 17:37978616-37978638 GGCTGAACACCCTGCGGAGCGGG - Intronic
1147080132 17:38014425-38014447 GGCTGAACACCCTGCGGAGCGGG + Intronic
1147085185 17:38058154-38058176 GGCTGAACACCCTGCGGAGCGGG - Exonic
1147096081 17:38138385-38138407 GGCTGAACACCCTGCGGAGCGGG + Intergenic
1147101131 17:38182120-38182142 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1147537412 17:41329524-41329546 GGCTGACCACACTGCGGAAGGGG + Intergenic
1149330701 17:55577960-55577982 GGCTGCACACTCCGTGGAGCTGG - Intergenic
1149845730 17:60008626-60008648 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1150084078 17:62265206-62265228 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1151895064 17:76974644-76974666 GGCTGTACACTCTACAGAGCAGG + Intergenic
1152011827 17:77723720-77723742 TGCTGAACACCCTTCAGTGCTGG + Intergenic
1152791708 17:82283634-82283656 GGGTGGACACCCTGGGGAGGAGG - Intergenic
1157981317 18:52384594-52384616 GGGTGAAGACCCTGTGTAGCAGG + Intronic
1158632879 18:59131773-59131795 GGCTGCACACCCCATGGAGCTGG + Intergenic
1159909064 18:74126669-74126691 GACTGAAATCCCTGAGGAGCTGG + Intronic
1162554966 19:11381156-11381178 TGCTGAGCAACCTGCGGGGCCGG - Exonic
1165157579 19:33797338-33797360 GGCCGAGCGCCCTGCAGAGCTGG + Intronic
1165593151 19:36988377-36988399 TCCTGAACAGCCTGTGGAGCTGG - Intronic
1168074370 19:53971563-53971585 GGCTGAAATCCCTGAGGAGGGGG - Intronic
926728697 2:16018307-16018329 GCCTCAGCACCCTGAGGAGCTGG + Intergenic
932419310 2:71592193-71592215 GGCCGAGCACCCTGCAGAGAGGG + Intronic
934295992 2:91743280-91743302 GGCTGGAGAGCCTGAGGAGCAGG + Intergenic
936111768 2:109670879-109670901 GGCTGCACTCCTTGGGGAGCAGG - Intergenic
938097663 2:128474115-128474137 GGCTCAAACCCCTGAGGAGCAGG - Intergenic
938287126 2:130128085-130128107 GGCTGCACTCCTTGGGGAGCAGG + Intronic
938428467 2:131210785-131210807 GGCTGCACTCCTTGGGGAGCAGG - Intronic
938469369 2:131544803-131544825 GGCTGCACTCCTTGGGGAGCAGG - Intergenic
945330246 2:208530490-208530512 GGCTGCACACTCTGTGGAGCCGG - Intronic
947765321 2:232633920-232633942 GGTTGAAGACCCTGCAGCGCCGG - Exonic
1172439013 20:34952336-34952358 GGCTGAACATTCTGGGGAGCTGG + Intronic
1175905671 20:62378219-62378241 GGCTGGGAACCCTGAGGAGCTGG + Intergenic
1183985932 22:41570429-41570451 GCCTGAACACCCTGCATGGCAGG - Intronic
949883441 3:8678411-8678433 GGGTGAACAGCCTGCGATGCTGG + Intronic
949982011 3:9508015-9508037 GGCTAAGCACCCTGTGGACCTGG - Intronic
952016030 3:28958777-28958799 GGCTGAAGACTCCACGGAGCAGG + Intergenic
953610428 3:44443173-44443195 GGCAGAACACTCTGGGGGGCTGG + Exonic
966875664 3:184320326-184320348 GGCTGCACACCCTGGGGCCCAGG - Intronic
968448946 4:666195-666217 GGCTGTACACAGTGCTGAGCCGG - Intronic
968455154 4:694014-694036 GGCTGAACAACATGAGGAGGTGG - Intergenic
968569495 4:1331984-1332006 GGCTGGACTCCCTGCAGATCCGG - Intronic
976387345 4:84475946-84475968 GGCTGAACACCCTTTGGGACAGG - Intergenic
980347699 4:131643831-131643853 GACTGAACACACTGAGGAACTGG - Intergenic
980740629 4:136946326-136946348 GGCTGCACACTCCACGGAGCTGG + Intergenic
982261071 4:153494891-153494913 GGGTGAACACCCGGCAGAGCAGG - Intronic
985916023 5:2919792-2919814 GGCTGCATACTCTGTGGAGCTGG + Intergenic
986284470 5:6349265-6349287 GGCTGAAGACCCTTCTGAGGGGG - Intergenic
986449312 5:7850294-7850316 GGCTGGACAGCCTGTGGAGGGGG - Intronic
995181129 5:109231246-109231268 GGCAGACCACCATGCGCAGCAGG - Intergenic
998411448 5:141914449-141914471 GGCTCAACTGCCTGCGGAGACGG - Intergenic
1002897936 6:1389977-1389999 GGCTGCACGCGCGGCGGAGCGGG - Exonic
1003147481 6:3520873-3520895 TGCTGAAGACCCTGCTGTGCTGG + Intergenic
1006187658 6:32190042-32190064 GGGTGAACCCCCGGGGGAGCCGG - Exonic
1006593961 6:35179251-35179273 GCCTAAACACCCTGGGGAGAGGG + Intergenic
1008909009 6:56713194-56713216 GTCTGAAGACCCTGGGCAGCTGG + Intronic
1013628154 6:111958022-111958044 GGCTGAGCTCCCTGTGGTGCTGG + Intergenic
1018660042 6:166077156-166077178 GGCTGCACACTCTGTAGAGCTGG - Intergenic
1019501203 7:1365535-1365557 AGCTGAAGACCCTGGTGAGCAGG - Intergenic
1019689071 7:2399819-2399841 GGCTCAACTCCCTGAGTAGCTGG - Intergenic
1020288773 7:6706630-6706652 GGCTCACCGTCCTGCGGAGCCGG + Exonic
1020381703 7:7554932-7554954 GGCAGCACAGCCTGAGGAGCTGG + Intergenic
1024919737 7:54544828-54544850 GGCCGGACACCCTGAGGACCGGG - Intronic
1025996078 7:66528318-66528340 GGCTGAACACCATTGGTAGCTGG + Intergenic
1034445371 7:151111311-151111333 TGCTCCACACCCTGCGGAGCTGG + Intronic
1036935940 8:13002939-13002961 GAGTGATCACCCTGAGGAGCTGG - Intronic
1038614055 8:29076601-29076623 TGGTGAGCACCCTGCTGAGCGGG - Intronic
1039210264 8:35205080-35205102 GGCTGAACACTCCCAGGAGCTGG - Intergenic
1039449341 8:37659099-37659121 GGCTGAACCTCCTGAGTAGCTGG - Intergenic
1041357430 8:57014854-57014876 GGCTGCACACTCCGTGGAGCTGG - Intergenic
1048526767 8:135210017-135210039 TGCTGAACACCATGCTGGGCAGG - Intergenic
1048950790 8:139495334-139495356 GGCTGTGCACCTTGCTGAGCAGG - Intergenic
1049442303 8:142614940-142614962 AGCTGCACATCCTGCAGAGCTGG - Intergenic
1049601664 8:143510594-143510616 CGCTGCACACCCTGGGGAACAGG - Intronic
1050130360 9:2406337-2406359 GGCTGCACACTCCGTGGAGCTGG + Intergenic
1050693966 9:8259219-8259241 GGCAGAGCACCCAGCTGAGCTGG - Intergenic
1051432949 9:16999030-16999052 GGCTTAACCCCCTGAGTAGCTGG - Intergenic
1052437017 9:28443354-28443376 GGCTGCACACTCTGTTGAGCTGG + Intronic
1057228799 9:93306383-93306405 GGCAGGACACCCTGCTGAGTCGG - Intronic
1061040922 9:128139889-128139911 GGGTGAACAGCCTGCGATGCTGG - Intergenic
1062338308 9:136082201-136082223 GGGTGAAGACCCTGGGGAGACGG - Intronic
1189083453 X:37997218-37997240 GGCTGCACACTTTGTGGAGCTGG + Intronic
1194179472 X:90694968-90694990 GGCTGAACACCCTGAGGACTAGG + Intergenic
1199016225 X:142819463-142819485 GGGAGAACTCCCTGGGGAGCAGG + Intergenic
1199436078 X:147814276-147814298 AGCTGAAGACCCTGGGGTGCTGG + Intergenic
1199745963 X:150772124-150772146 GGCTGAAAACACTGAGAAGCTGG - Intronic
1199861238 X:151801776-151801798 GGCTGCACACTGTGTGGAGCTGG - Intergenic
1200244649 X:154516411-154516433 GCCTGAACGCACTGCGGAGGTGG - Intergenic
1200526136 Y:4277141-4277163 GGCTGAACACCCTGAGGACTAGG + Intergenic
1201189642 Y:11436000-11436022 GGCTGCACTCCTTGGGGAGCAGG - Intergenic