ID: 1147073668

View in Genome Browser
Species Human (GRCh38)
Location 17:37978627-37978649
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 11, 1: 0, 2: 1, 3: 18, 4: 166}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147073660_1147073668 30 Left 1147073660 17:37978574-37978596 CCTGGTCGGAATCAGTGCTGGGT 0: 14
1: 1
2: 1
3: 7
4: 83
Right 1147073668 17:37978627-37978649 GGGTGTTCAGCCTGCCAGCAGGG 0: 11
1: 0
2: 1
3: 18
4: 166
1147073662_1147073668 -3 Left 1147073662 17:37978607-37978629 CCGATCTCACCCGCTCCGCAGGG 0: 14
1: 0
2: 2
3: 8
4: 91
Right 1147073668 17:37978627-37978649 GGGTGTTCAGCCTGCCAGCAGGG 0: 11
1: 0
2: 1
3: 18
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900400198 1:2469887-2469909 GGGTCTTCACCCAGCTAGCATGG - Intronic
902992215 1:20196288-20196310 GGGTGCCCACCCTGCCAGCTGGG + Intergenic
903891234 1:26571913-26571935 GGGCACTCACCCTGCCAGCATGG - Exonic
904220238 1:28961474-28961496 GGGTGTTCAGATTCCCAGCCTGG - Intronic
905800744 1:40840706-40840728 GAGAGGTCAGCCTGCCAGAAAGG - Intergenic
907497526 1:54854784-54854806 GGGTGGTCAGGCTGTGAGCAAGG - Intronic
912690431 1:111800817-111800839 GGGCTTTCTACCTGCCAGCATGG - Intronic
917620092 1:176786714-176786736 GGGTCTGCATCCTGCCTGCAGGG + Intronic
918456656 1:184726933-184726955 GTGTTGTTAGCCTGCCAGCAAGG - Intronic
919818865 1:201460086-201460108 GGTTGGTCAGCCAGCAAGCAGGG + Intergenic
919982369 1:202650266-202650288 GGGTGTCCAGCCTGCCTGAGAGG + Intronic
923529194 1:234800175-234800197 GGGTGTTGAATTTGCCAGCACGG + Intergenic
924646292 1:245880366-245880388 GGTTGTTCAGCCAGCCAGCCAGG - Intronic
1062786496 10:269665-269687 GAGAGCTCAGCCTCCCAGCAAGG - Intergenic
1067715997 10:48691464-48691486 GGGTTGCCAGCCGGCCAGCAGGG - Intronic
1070797817 10:79227263-79227285 GGGTGTTTAACCTACCAGCAAGG - Intronic
1071265754 10:83963349-83963371 GGAAGATCAGGCTGCCAGCATGG - Intergenic
1072891747 10:99330275-99330297 AGGTGTACAGCCAGCCAGCCAGG - Exonic
1076145422 10:128115414-128115436 GTCTGTTCAGACTCCCAGCAAGG - Exonic
1076445615 10:130512046-130512068 CTGTGGTCAGGCTGCCAGCATGG + Intergenic
1078448625 11:11424063-11424085 TGGTGTTCAGGCTTCCAGCTGGG - Intronic
1084860080 11:72012500-72012522 GTGAGGTCAGCCTGGCAGCAGGG - Intronic
1089289933 11:117431499-117431521 AGGTGTTCAGGATGCCAGCAGGG + Intronic
1091943744 12:4514801-4514823 GTGGGTGCAGCGTGCCAGCATGG + Intronic
1094488697 12:30945197-30945219 GGGTGTTCATTCTGCCAGACAGG - Intronic
1096308354 12:50498719-50498741 GGGTGTTCCACCTTCCGGCATGG + Intergenic
1097246070 12:57608508-57608530 GGGTGTTCAGCCTGGGAGGAAGG - Exonic
1097246677 12:57611179-57611201 CGGGGTTCAGCCTGTCTGCAGGG - Intronic
1100477713 12:94949317-94949339 GGGTGTGCACTCTGACAGCATGG - Intronic
1102026317 12:109715820-109715842 GGAACTTCAGCCTGCCAGCTGGG - Intronic
1102260987 12:111443162-111443184 GGCTGTTCAGCCCGCCTGGAGGG - Intronic
1103910335 12:124348580-124348602 GGGTGCTCTGTCTGCAAGCAAGG + Intronic
1103931593 12:124453581-124453603 GGGCTTTGAGCCAGCCAGCAGGG + Intronic
1104881909 12:132077628-132077650 GTGTCTTTAGCCTGACAGCAGGG - Exonic
1106101936 13:26701072-26701094 GGGTTTTCACCATGTCAGCAAGG + Intergenic
1117879858 14:60302713-60302735 TGGTTTTCAACCTGCCAGCAAGG + Intergenic
1118081981 14:62371766-62371788 GGGAGATCAGAGTGCCAGCATGG + Intergenic
1121052702 14:90829942-90829964 GGATGTCCAGCCTCCCAGCCTGG + Intergenic
1121469313 14:94139612-94139634 GGGCCTCCGGCCTGCCAGCATGG + Intergenic
1121661988 14:95641900-95641922 GCGTGCTCAGCCTTCCAACATGG + Intergenic
1124629617 15:31328876-31328898 GGGTTTTGAGCCTGCCCCCAAGG - Intronic
1124964491 15:34423176-34423198 GGGTGGTCAGCTTTCCAGGAAGG - Intronic
1124981111 15:34569402-34569424 GGGTGGTCAGCTTTCCAGGAAGG - Intronic
1128392722 15:67193553-67193575 AGGTCTACAGCCTGCCAGGAAGG - Exonic
1129834453 15:78693206-78693228 TGGAGATCAGGCTGCCAGCATGG - Intronic
1130980038 15:88806017-88806039 GGGTGGACAGCCTGCATGCAAGG + Intronic
1133500615 16:6362951-6362973 GGTTGTACAGCCTGCCACCTGGG + Intronic
1133570005 16:7031835-7031857 GTGTGTCCAGCAGGCCAGCAAGG - Intronic
1136405740 16:30045886-30045908 GGGTGTGCAGCCAGAAAGCATGG + Intronic
1138148358 16:54632570-54632592 AATTGTTCAGCCTGTCAGCAGGG + Intergenic
1138735763 16:59248415-59248437 GGCTCTTCACCCTGCCTGCAAGG - Intergenic
1139250637 16:65492147-65492169 AGGTTTTCTGCCTGCCTGCATGG - Intergenic
1139591235 16:67934453-67934475 GGGTGGGCAGGCAGCCAGCAGGG - Intronic
1139704522 16:68732139-68732161 GGCTGGGCTGCCTGCCAGCATGG - Intergenic
1141404168 16:83777132-83777154 GGCTGGTCCGCCTGCCTGCAGGG + Intronic
1141469959 16:84231416-84231438 TGGTGTTCAGGCTGCCAGGAGGG + Intronic
1141820850 16:86444457-86444479 GGGTGCCCAGCCAGCCAGCCAGG - Intergenic
1142013161 16:87727415-87727437 GTGTGAGCAGCCTGGCAGCAAGG + Intronic
1142156510 16:88534823-88534845 GGGCGTCCAGACTCCCAGCAAGG + Exonic
1142435902 16:90057112-90057134 GTGTGTTAAGCCTGCATGCATGG - Intronic
1142638732 17:1272690-1272712 GGATGCTCAGCGTGCCAGCCAGG - Intergenic
1143267376 17:5650057-5650079 GGATGTGCAGCCTTCCAGCCAGG - Intergenic
1144810273 17:17994422-17994444 GGGCGTGCAGCCTGCCGGAACGG - Intronic
1145814376 17:27784973-27784995 GGGTGTTCAGAAGCCCAGCAGGG - Intronic
1145971664 17:28959880-28959902 TGGTTTACAGCCTTCCAGCAGGG - Exonic
1146842572 17:36166152-36166174 GGGTGTTCAGCCTGCCAGCAGGG + Exonic
1146854884 17:36254111-36254133 GGGTGTTCAGCCTGCCAGCAGGG + Exonic
1146865736 17:36334265-36334287 GGGTGTTCAGCCTGCCAGCAGGG - Exonic
1146870784 17:36378003-36378025 GGGTGTTCAGCCTGCCAGCAGGG + Exonic
1146882092 17:36450231-36450253 GGGTGTTCAGCCTGCCAGCAGGG + Intergenic
1147068606 17:37934877-37934899 GGGTGTTCAGCCTGCCAGCAGGG - Exonic
1147073668 17:37978627-37978649 GGGTGTTCAGCCTGCCAGCAGGG + Intronic
1147080128 17:38014414-38014436 GGGTGTTCAGCCTGCCAGCAGGG - Intronic
1147085189 17:38058165-38058187 GGGTGTTCAGCCTGCCAGCAGGG + Exonic
1147096077 17:38138374-38138396 GGGTGTTCAGCCTGCCAGCAGGG - Intergenic
1147101135 17:38182131-38182153 GGGTGTTCAGCCTGCCAGCAGGG + Intergenic
1147350208 17:39836253-39836275 GGGTGTCCTGGGTGCCAGCATGG - Intronic
1148439354 17:47703568-47703590 TGGTGCTTTGCCTGCCAGCAGGG + Intronic
1157337651 18:46753377-46753399 GGGTTTTCAGCCTGTTAGCCAGG - Intronic
1165186939 19:34030770-34030792 GGGTGTTCAGCCAGAAAGCTGGG + Intergenic
1166907232 19:46119803-46119825 GGGGGTGCAGCTTGCCGGCAAGG + Intergenic
1167353674 19:48991249-48991271 GGGTGGACAGCCTGCCATCGGGG - Intronic
925244198 2:2365506-2365528 GGGCGTTCATTCAGCCAGCAAGG - Intergenic
925980877 2:9176263-9176285 GGGTGTTCAGTCTGCCATGTGGG + Intergenic
927512678 2:23654206-23654228 AGGTGTTCAGGCTCCCAGGAAGG - Intronic
931272421 2:60714760-60714782 GGGAGATCAGCCTTTCAGCAGGG + Intergenic
931917058 2:66967807-66967829 GGGAGCCCAGCCTTCCAGCAGGG - Intergenic
934558046 2:95297686-95297708 AGGAGTTCAGCCTCCCAGCCAGG - Intronic
934577185 2:95410453-95410475 TGGTGTGCAGCCTCTCAGCATGG + Intronic
934768438 2:96893617-96893639 GGGTTGTCAGCCTTACAGCATGG - Intronic
936062764 2:109306435-109306457 GTATGTGCAGCCTGCCTGCAAGG - Intronic
937683624 2:124671051-124671073 GGGAGTTCAGCCTGTCGCCACGG + Intronic
943574457 2:189614788-189614810 GAGAGATCAACCTGCCAGCAAGG + Intergenic
946328826 2:218998635-218998657 GGGTGGTCAGGCTGCAAGCATGG + Intergenic
948753437 2:240145183-240145205 GGGTGGTCGGCCTGCAGGCACGG - Intergenic
948854695 2:240724711-240724733 GCGTGTTCAGCACGCAAGCACGG + Intronic
1171991391 20:31699236-31699258 GGGTGTTCCACCTGTCTGCAGGG - Intronic
1172313052 20:33932877-33932899 GGTTGTTCAGCCTGACATGATGG + Intergenic
1172690131 20:36784348-36784370 TGGTGTTCAGCCTGCAGGGAAGG + Exonic
1172969547 20:38863355-38863377 GGGAGTTAAACCTGTCAGCAGGG - Intronic
1173667515 20:44773536-44773558 GTGTGTGCTGCCTGCCTGCAGGG - Intronic
1175706595 20:61183167-61183189 GGGTCCCCAGCCTGCCAGCAAGG + Intergenic
1175725848 20:61317813-61317835 GGGTGTCCAGCCAGCCAGCAAGG + Intronic
1176117570 20:63439753-63439775 GGGCGTCCAGCCTGCCCTCAGGG - Intronic
1181172230 22:21016133-21016155 GGGTGTTCAGGCTGTCAGTGGGG - Intronic
1181614945 22:24047592-24047614 GGCTGTGCAGCCTGTGAGCAAGG - Intronic
1181690798 22:24558830-24558852 GTGTGTTCAGGCTGGCAACATGG + Intronic
1182866762 22:33610970-33610992 GGGTGTTAAGCCTGTCAGGACGG + Intronic
1183711402 22:39505881-39505903 GGGTGTAAGGCCTGCCAGCTGGG + Intronic
1185049023 22:48544050-48544072 GGGTGCTCAGCAGGACAGCAGGG + Intronic
951920426 3:27848529-27848551 GGCTGTTAAGACTGCCACCAAGG + Intergenic
952691919 3:36218591-36218613 GAATGTTCAGTCTGGCAGCAGGG - Intergenic
952812162 3:37413695-37413717 GGGTGCCCTGCATGCCAGCAGGG - Intronic
952823424 3:37504943-37504965 GAGCTTTCAGCCTGCTAGCAAGG + Intronic
952849183 3:37713743-37713765 GGGCATGCTGCCTGCCAGCAAGG + Intronic
953460602 3:43078876-43078898 AGATGCTCAGCATGCCAGCAGGG - Intergenic
954401775 3:50322908-50322930 GGGAGGGCAGCCAGCCAGCAGGG - Intronic
954446847 3:50551466-50551488 GGGCCTCCAGCCTGCTAGCAGGG + Intergenic
954448685 3:50560188-50560210 GGGTCTTCAGACTTCCAGCCTGG + Intronic
954541215 3:51393903-51393925 GGGTGATCAGCTTGCCAGTGGGG + Exonic
954709705 3:52499384-52499406 AGGAGTCCAGCCTGCCACCACGG - Intronic
956165561 3:66395882-66395904 GGCTGTTCTGCCTGACTGCACGG - Intronic
956667160 3:71652913-71652935 GTGTGCTCAGCCTGCAAGCCTGG + Intergenic
956788387 3:72661389-72661411 AGGTGTCCTGCCTGGCAGCAGGG - Intergenic
958418362 3:93903893-93903915 GTGGGTGCAGCGTGCCAGCATGG - Intronic
958496652 3:94851938-94851960 GTGGGTTCAGCGTGCCAGCATGG + Intergenic
959309147 3:104709605-104709627 GGGTGTGCATCCTGCCAGAGTGG - Intergenic
961201424 3:125048688-125048710 GGGTGTTAAGCCTCCGAGTAAGG + Intronic
961449740 3:126997268-126997290 GGGGTTTCAGCCTGGGAGCAAGG + Intronic
962496466 3:135945221-135945243 GGGTGTGCAGCTTGTCAGCTTGG + Intergenic
968912376 4:3482873-3482895 AGGTGCTCAGCCTGGCAGCCGGG + Intronic
968923538 4:3535099-3535121 GAGTGTTCAGCCTGACTTCAGGG + Intergenic
968978775 4:3835579-3835601 AGGTGTGGAGCCTGCCAGCCAGG - Intergenic
969376805 4:6768486-6768508 TGGTGCTCAGCCTGCCATCCAGG + Intergenic
969666139 4:8558493-8558515 GAGTGTACAGCATGCCACCATGG - Intergenic
970158924 4:13169963-13169985 GGGTGTTCCCAGTGCCAGCATGG - Intergenic
978511150 4:109519647-109519669 GGATGTTCAGCTTACCAGTATGG - Intronic
978556803 4:109989829-109989851 GTGTGCTCACCCTGCCTGCATGG + Intronic
980332631 4:131428997-131429019 GGGTGATCAGGGTGCCAGCCTGG - Intergenic
985810786 5:2082857-2082879 GGGTGTTCATTCTGAGAGCAAGG + Intergenic
989790811 5:45399104-45399126 GGGTGTTCTCCCTGCCTGCATGG + Intronic
992019801 5:72611294-72611316 GGCTTTGCAGCCTGCCAGCAGGG + Intergenic
994196740 5:96930538-96930560 GTGGGGTCAGCCTGTCAGCATGG + Intronic
995574414 5:113514102-113514124 GGGTATCCTGACTGCCAGCATGG - Intronic
995967823 5:117930824-117930846 GTGGGTGCAGCGTGCCAGCATGG - Intergenic
996799512 5:127387584-127387606 GGGTGTTCAGCGTGGCATAAGGG + Intronic
997265908 5:132495476-132495498 GGGTCATCACCCTGCCTGCAAGG + Intergenic
998364421 5:141619310-141619332 GGCTGTACAGCCTGACAGCCTGG + Intergenic
998399045 5:141838422-141838444 GGCTGCTCAGCCTGCCAGGCGGG + Intergenic
998614566 5:143726169-143726191 GGGGTTTCAGCATGCCAGCCAGG - Intergenic
998702420 5:144717981-144718003 GTGGGTGCAGCGTGCCAGCATGG + Intergenic
1002790807 6:436069-436091 GGCTGTGAAGGCTGCCAGCACGG + Intergenic
1002798701 6:499757-499779 TGGGGTACAGCCTGCCAGCAGGG - Intronic
1006126996 6:31845383-31845405 GGGAGTTCAGCCTGGGAGGATGG - Intergenic
1006212192 6:32405350-32405372 GGGTGTCCAGCCTGTCAAAATGG + Intronic
1007750830 6:44070269-44070291 GGGTGTGCCCTCTGCCAGCATGG - Intergenic
1012426355 6:99119160-99119182 AGGAGTTCAGGCTGCCAGGAAGG + Intergenic
1014802226 6:125790544-125790566 GGGTGCCCAGCCTCCCAGCTCGG + Intronic
1015647274 6:135406777-135406799 GAGTGTTCAGGCTGCCAGAATGG + Intronic
1017740050 6:157398354-157398376 GGAGGGGCAGCCTGCCAGCAGGG + Intronic
1018761311 6:166896385-166896407 CAGTGTTCAGCTTGCCAACAGGG + Intronic
1021597893 7:22336567-22336589 GGGTCTTCAGACAGCCAGCTGGG + Intronic
1022401424 7:30042173-30042195 GGGTCTTGAGCCTGCTAGCATGG + Intronic
1023674098 7:42612428-42612450 GGGTGTTCATCCTTCCATCTAGG + Intergenic
1023978920 7:45054587-45054609 AGGTGGTGAGCCTGCCAGCGTGG + Intronic
1029227940 7:99041636-99041658 GGGTGGGCAGCCGGCCAGCAGGG - Intronic
1029489179 7:100861146-100861168 GTGTGTTCAGCTTCCCAGCCAGG - Exonic
1034750597 7:153565075-153565097 GGGTGGTCGGCCAGCCAGCGGGG + Intergenic
1035375953 7:158407010-158407032 GCGTGCTCAGGCTGTCAGCAAGG + Intronic
1037429609 8:18795672-18795694 GGGTGATAATCCTGCCAGGACGG + Intronic
1037457647 8:19080088-19080110 CTGAGTTCAGCCTGCCAACATGG - Intronic
1038729151 8:30111785-30111807 GGGTCTTGTGCCAGCCAGCAGGG + Intronic
1040512666 8:48108711-48108733 GGGTGTTCTGCCTGACTGCTGGG - Intergenic
1040989465 8:53334732-53334754 AGGTGTTTTGCCTGACAGCACGG + Intergenic
1045675506 8:104603399-104603421 GAGTCTCCAGCCTGCCAGCTTGG - Intronic
1047370180 8:124249740-124249762 GGGTGTTGGGCCTTGCAGCAGGG + Intergenic
1049287812 8:141786033-141786055 TGGTGCTCAGCATGCCAGGAGGG - Intergenic
1051668644 9:19488777-19488799 GTGGGTTCAGCCTGCAACCATGG + Intergenic
1053194239 9:36103180-36103202 AAGTGTTCAGGCTGCCACCAGGG + Intronic
1053799249 9:41754123-41754145 GAGTGTTCAGCCTGACTTCAGGG + Intergenic
1054145963 9:61560876-61560898 GAGTGTTCAGCCTGACTTCAGGG - Intergenic
1054187659 9:61966182-61966204 GAGTGTTCAGCCTGACTTCAGGG + Intergenic
1054650857 9:67622399-67622421 GAGTGTTCAGCCTGACTTCAGGG - Intergenic
1055414623 9:76067938-76067960 GTGTGTTCTGCCTGCAGGCATGG + Exonic
1058508186 9:105688004-105688026 GTTTGTTCAGCCTCTCAGCAAGG - Intergenic
1058675151 9:107393903-107393925 GGTTGTACATCCTTCCAGCAAGG + Intergenic
1061407347 9:130399693-130399715 GGGTGCTCTCCCTGCCAGCAGGG + Intronic
1061626484 9:131843547-131843569 GTGGCTTCAGCCTGCCTGCAAGG - Intergenic
1061675299 9:132212194-132212216 GGGTGTTGGGCCTTCCTGCAGGG + Intronic
1062418100 9:136463786-136463808 GGTTGGCCGGCCTGCCAGCAGGG - Intronic
1186459857 X:9739629-9739651 GGGTTTTCAGTCTCCCAGGAAGG - Exonic
1188583855 X:31749221-31749243 GTGGGTGCAGCGTGCCAGCATGG - Intronic
1191754906 X:64582472-64582494 GGGAGTTCAGCCAGCCAGTCGGG - Intergenic
1193688098 X:84604371-84604393 GTGGGTGCAGCGTGCCAGCATGG - Intergenic
1198033543 X:132779066-132779088 GGGTGCACAAACTGCCAGCAGGG + Intronic
1199982074 X:152926634-152926656 GGGTGTGCAGCCTTCCAGCGTGG + Intronic