ID: 1147074135

View in Genome Browser
Species Human (GRCh38)
Location 17:37980432-37980454
Sequence GATCCTCTGTTCTGGCCCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 291
Summary {0: 14, 1: 5, 2: 2, 3: 15, 4: 255}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147074135_1147074141 16 Left 1147074135 17:37980432-37980454 CCTCTGGGCCAGAACAGAGGATC 0: 14
1: 5
2: 2
3: 15
4: 255
Right 1147074141 17:37980471-37980493 GAAGCTGCCCTCGGGCCAGTCGG 0: 14
1: 4
2: 3
3: 12
4: 122
1147074135_1147074146 30 Left 1147074135 17:37980432-37980454 CCTCTGGGCCAGAACAGAGGATC 0: 14
1: 5
2: 2
3: 15
4: 255
Right 1147074146 17:37980485-37980507 GCCAGTCGGGGTCTGACCCCAGG 0: 14
1: 0
2: 2
3: 25
4: 112
1147074135_1147074138 -6 Left 1147074135 17:37980432-37980454 CCTCTGGGCCAGAACAGAGGATC 0: 14
1: 5
2: 2
3: 15
4: 255
Right 1147074138 17:37980449-37980471 AGGATCATGAGGACAGTGTGAGG 0: 15
1: 6
2: 6
3: 63
4: 768
1147074135_1147074142 17 Left 1147074135 17:37980432-37980454 CCTCTGGGCCAGAACAGAGGATC 0: 14
1: 5
2: 2
3: 15
4: 255
Right 1147074142 17:37980472-37980494 AAGCTGCCCTCGGGCCAGTCGGG 0: 14
1: 6
2: 1
3: 6
4: 94
1147074135_1147074143 18 Left 1147074135 17:37980432-37980454 CCTCTGGGCCAGAACAGAGGATC 0: 14
1: 5
2: 2
3: 15
4: 255
Right 1147074143 17:37980473-37980495 AGCTGCCCTCGGGCCAGTCGGGG 0: 14
1: 2
2: 2
3: 9
4: 119
1147074135_1147074139 7 Left 1147074135 17:37980432-37980454 CCTCTGGGCCAGAACAGAGGATC 0: 14
1: 5
2: 2
3: 15
4: 255
Right 1147074139 17:37980462-37980484 CAGTGTGAGGAAGCTGCCCTCGG 0: 20
1: 0
2: 2
3: 47
4: 349
1147074135_1147074140 8 Left 1147074135 17:37980432-37980454 CCTCTGGGCCAGAACAGAGGATC 0: 14
1: 5
2: 2
3: 15
4: 255
Right 1147074140 17:37980463-37980485 AGTGTGAGGAAGCTGCCCTCGGG 0: 15
1: 7
2: 3
3: 24
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147074135 Original CRISPR GATCCTCTGTTCTGGCCCAG AGG (reversed) Intronic