ID: 1147074802

View in Genome Browser
Species Human (GRCh38)
Location 17:37983412-37983434
Sequence GATGAAGGAGTCGCCCCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 14, 1: 1, 2: 5, 3: 3, 4: 100}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147074802_1147074807 -4 Left 1147074802 17:37983412-37983434 CCTCCTGGGGCGACTCCTTCATC 0: 14
1: 1
2: 5
3: 3
4: 100
Right 1147074807 17:37983431-37983453 CATCCTCCAAGTCTCCAGGGTGG 0: 17
1: 0
2: 4
3: 22
4: 214
1147074802_1147074805 -8 Left 1147074802 17:37983412-37983434 CCTCCTGGGGCGACTCCTTCATC 0: 14
1: 1
2: 5
3: 3
4: 100
Right 1147074805 17:37983427-37983449 CCTTCATCCTCCAAGTCTCCAGG 0: 18
1: 1
2: 2
3: 36
4: 298
1147074802_1147074806 -7 Left 1147074802 17:37983412-37983434 CCTCCTGGGGCGACTCCTTCATC 0: 14
1: 1
2: 5
3: 3
4: 100
Right 1147074806 17:37983428-37983450 CTTCATCCTCCAAGTCTCCAGGG 0: 18
1: 0
2: 5
3: 29
4: 280

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147074802 Original CRISPR GATGAAGGAGTCGCCCCAGG AGG (reversed) Intronic