ID: 1147075441

View in Genome Browser
Species Human (GRCh38)
Location 17:37986312-37986334
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 463
Summary {0: 11, 1: 0, 2: 3, 3: 24, 4: 425}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147075441_1147075451 7 Left 1147075441 17:37986312-37986334 CCCCCCGCCAGGGTCAAGGGAGC 0: 11
1: 0
2: 3
3: 24
4: 425
Right 1147075451 17:37986342-37986364 GAGACCTGCCCGGTGTACTCTGG 0: 14
1: 2
2: 1
3: 19
4: 84
1147075441_1147075455 17 Left 1147075441 17:37986312-37986334 CCCCCCGCCAGGGTCAAGGGAGC 0: 11
1: 0
2: 3
3: 24
4: 425
Right 1147075455 17:37986352-37986374 CGGTGTACTCTGGCTGCACCAGG 0: 11
1: 2
2: 4
3: 5
4: 60
1147075441_1147075456 18 Left 1147075441 17:37986312-37986334 CCCCCCGCCAGGGTCAAGGGAGC 0: 11
1: 0
2: 3
3: 24
4: 425
Right 1147075456 17:37986353-37986375 GGTGTACTCTGGCTGCACCAGGG 0: 11
1: 2
2: 4
3: 8
4: 166
1147075441_1147075457 19 Left 1147075441 17:37986312-37986334 CCCCCCGCCAGGGTCAAGGGAGC 0: 11
1: 0
2: 3
3: 24
4: 425
Right 1147075457 17:37986354-37986376 GTGTACTCTGGCTGCACCAGGGG 0: 11
1: 4
2: 3
3: 11
4: 147
1147075441_1147075447 -3 Left 1147075441 17:37986312-37986334 CCCCCCGCCAGGGTCAAGGGAGC 0: 11
1: 0
2: 3
3: 24
4: 425
Right 1147075447 17:37986332-37986354 AGCCTGCCCTGAGACCTGCCCGG 0: 14
1: 2
2: 5
3: 39
4: 323

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147075441 Original CRISPR GCTCCCTTGACCCTGGCGGG GGG (reversed) Intronic
900302791 1:1986373-1986395 GTTCCCTTGCCCCTGGCTGCTGG + Intronic
900325763 1:2107967-2107989 GCTCCCTTGACACTGTCTGGGGG - Intronic
900494906 1:2971961-2971983 GCTGACTTGACCTTGGAGGGTGG + Intergenic
900590047 1:3455362-3455384 CCACCCTTGACCTTGGTGGGCGG + Intronic
900698018 1:4024387-4024409 GCACCCCTGATCCTGGCTGGTGG + Intergenic
900791585 1:4684347-4684369 GCTTCCTAGACCCAGGCAGGAGG - Intronic
900798745 1:4725069-4725091 GCTCCCTGGACCCTGAGGGCTGG - Intronic
901604745 1:10450278-10450300 GCTGCCCTGCCCCTGGAGGGTGG + Exonic
902689200 1:18099294-18099316 TCTCCATTGACCCTGGCAAGAGG - Intergenic
902923606 1:19681414-19681436 AATCCCTTGAACCTGGCAGGTGG + Intergenic
902927158 1:19703632-19703654 GATCGCTTGAACCTGGGGGGTGG - Intronic
903251237 1:22054300-22054322 GCTCACTTGACCCCGGGAGGCGG - Intronic
903414300 1:23171001-23171023 GATCCCTTGAACCTGGGAGGTGG + Intronic
903819134 1:26087775-26087797 AATCCCTTGACCCCGGGGGGCGG + Intergenic
903900663 1:26642773-26642795 AATCCCTTGAACCTGGGGGGCGG + Intergenic
904074171 1:27827376-27827398 AATCACTTGAACCTGGCGGGTGG + Intergenic
904232266 1:29085635-29085657 GATCACTTGAGCCTGGCAGGTGG - Intronic
904459624 1:30668471-30668493 ACTCCCTTGAACCTGGGAGGTGG + Intergenic
904522907 1:31109914-31109936 GATCCCTTGAGCCTGGGAGGTGG - Intergenic
905155595 1:35977477-35977499 GATCGCTTGACCCTGGGAGGTGG - Intronic
906062661 1:42958590-42958612 GCGCCTTTGTTCCTGGCGGGAGG + Intronic
906542205 1:46595836-46595858 GATCACTTGAGCCTGGCAGGTGG - Intronic
906639625 1:47433848-47433870 GCTCCCTTAGCCCAGGTGGGAGG - Intergenic
907373376 1:54017315-54017337 GCTCCCTTGAAGCTGGCAGTTGG - Intronic
907466235 1:54639373-54639395 GATCCCTTGATCCTGGCAGGGGG + Intergenic
907691524 1:56672202-56672224 GATCCCTTGAGCCTGGGAGGCGG - Intronic
907747463 1:57227641-57227663 GCTCGCTTGAGCCTGGGAGGTGG - Intronic
913372977 1:118121175-118121197 CCTCCTCTGACCCTGGCTGGAGG - Intronic
914816702 1:151068669-151068691 GATCCCTTGACCCTGGTGGGTGG - Intronic
914871106 1:151474739-151474761 GCTCCCTTGACCTTGGATTGTGG + Intergenic
915498101 1:156295231-156295253 ACTCCCCTGACCCTGGTGGGCGG + Intronic
915551422 1:156637439-156637461 GATCCCTTGAACCTGGGAGGCGG - Intergenic
916617106 1:166453381-166453403 ACTCACTTGAACCTGGCAGGTGG - Intergenic
916677324 1:167074986-167075008 AATCACTTGAACCTGGCGGGAGG - Intronic
917388660 1:174507022-174507044 GATCCCTTGAGCCTGGGAGGCGG + Intronic
917819519 1:178748231-178748253 GATCCCTTGAACCTGGGAGGTGG + Intronic
918488514 1:185054782-185054804 GATCGCTTGACCCCGGCAGGCGG - Intronic
918851635 1:189697393-189697415 AGTCGCTTGAGCCTGGCGGGCGG + Intergenic
919971763 1:202585081-202585103 GATCCCTTGAGCCTGGGAGGTGG - Exonic
920670375 1:207999622-207999644 GCTCCCTTGTCCCCAGCTGGTGG + Intergenic
922235215 1:223717569-223717591 GCTCCCTGGGCCCTGATGGGTGG - Intronic
923722796 1:236481690-236481712 GATCGCTTGAGCCTGGAGGGCGG + Intronic
924325776 1:242892623-242892645 TCTCCCTTGTGCCTGGCTGGGGG + Intergenic
924688047 1:246316444-246316466 ACTCCCTTGAACCTGGGAGGGGG - Intronic
1062825791 10:567722-567744 GATCCCTTGATCCTGGGAGGCGG - Intronic
1062871013 10:904465-904487 GCTCACTTGAGCCTGGGGGGCGG + Intronic
1063270090 10:4498520-4498542 GCTGCCTTGACGCTGGAGGTAGG + Intergenic
1063689235 10:8270118-8270140 GCTCACTTGAGCCTGGAAGGAGG - Intergenic
1066059647 10:31710859-31710881 AATCCCTTGAACCTGGTGGGTGG + Intergenic
1066105002 10:32148662-32148684 GATCGCTTGAACCTGGCAGGCGG - Intergenic
1067392702 10:45879146-45879168 ACTCACTTGAACCTGGAGGGTGG + Intergenic
1067449426 10:46372465-46372487 ACTCCCTTGAACCTGGGAGGTGG + Intronic
1067587949 10:47488295-47488317 ACTCCCTTGAACCTGGGAGGCGG - Intronic
1067635069 10:47996403-47996425 ACTCCCTTGAACCTGGGAGGCGG - Intergenic
1067861028 10:49848260-49848282 ACTCACTTGAACCTGGAGGGTGG + Intronic
1068636075 10:59349674-59349696 GATCCCTTGAGCCTGGGAGGCGG + Intronic
1070967849 10:80540459-80540481 GCTCCCGTGTCCCTGCGGGGTGG + Intronic
1071610047 10:87023632-87023654 ACTCCCTTGAACCTGGGAGGCGG + Intronic
1071699143 10:87910511-87910533 AATCACTTGAACCTGGCGGGAGG - Intronic
1072635655 10:97176278-97176300 GCTCCTTTGAGGCTGGCGAGAGG + Intronic
1072893876 10:99348981-99349003 GATCCCTTGAGCCTGGGAGGCGG + Intronic
1073052107 10:100674067-100674089 GATCCCTTGAGCCTGGGAGGCGG - Intergenic
1073694084 10:105845644-105845666 GATCCCTTGAGCCTGGGAGGTGG + Intergenic
1073970624 10:109042843-109042865 GGTCCCTTGACCCTGCTGGTAGG - Intergenic
1074056769 10:109929336-109929358 GATCCCTTGAACCTGGGAGGTGG - Intergenic
1074371390 10:112903486-112903508 AATCCCTTGACCCTGGGAGGTGG - Intergenic
1074374766 10:112930688-112930710 GATCCCTTGAGCCTGGGAGGCGG + Intergenic
1074839015 10:117329857-117329879 GATTGCTTGAGCCTGGCGGGTGG + Intronic
1075606458 10:123814936-123814958 GATCACTTGAACCTGGAGGGTGG + Intronic
1075709110 10:124521296-124521318 GCTCCATAGAGCCTGGCTGGGGG - Intronic
1076257269 10:129037614-129037636 GATCGCTTGAACCTGGCAGGTGG - Intergenic
1076811633 10:132889305-132889327 GCTCCCTAGACCCAGCCGGTCGG - Intronic
1077322286 11:1947707-1947729 GCTCCCTCGGCCCTGGCTGCGGG - Intronic
1078158533 11:8819305-8819327 GCTCACTTGAGCCTAGCAGGAGG + Intronic
1078593863 11:12670000-12670022 GCTCACTTGAGCCTGGGAGGTGG + Intergenic
1079577826 11:22025343-22025365 GCTCACTGGAGCCTGGCTGGGGG + Intergenic
1079764299 11:24371481-24371503 GATCACTTGAGCCTGGAGGGAGG - Intergenic
1081807351 11:45897753-45897775 CCTGCCTTGACCCTGGGAGGAGG + Intronic
1082051466 11:47773801-47773823 ACTCGCTTGAACCTGGCGGGTGG + Intergenic
1082714507 11:56595055-56595077 AATCGCTTGACCCTGGGGGGCGG + Intergenic
1083899181 11:65635499-65635521 GGCCCCCTGACCCTGGCGTGTGG + Intronic
1083977426 11:66134677-66134699 GCTCCCTGTACCCTGGCGCCAGG + Intronic
1084042899 11:66552768-66552790 AATCCCTTGACCCTGGGAGGCGG + Intronic
1084500642 11:69533300-69533322 GATCACTTGAGCCTGGGGGGTGG - Intergenic
1084975641 11:72796249-72796271 AATCCCTTGAACCTGGCAGGCGG - Intergenic
1085186269 11:74578640-74578662 ACTCCCTTGAACCTGGGAGGTGG + Intronic
1086165412 11:83772321-83772343 GATCCCTTGAGCCTGGGAGGTGG + Intronic
1086421563 11:86642614-86642636 GATCCCTTAACCCTGGGAGGTGG + Intronic
1087228914 11:95637613-95637635 GATCCCTTGAACCTGGGAGGTGG - Intergenic
1087254894 11:95942790-95942812 GATCGCTTGAACCTGGCAGGCGG - Intergenic
1089193965 11:116680649-116680671 GATCCCTTGAGCCTGGGAGGAGG - Intergenic
1089270343 11:117297531-117297553 ACTCACTTGACCCTGGGAGGTGG + Intronic
1091342003 11:134823305-134823327 GCCCCCTTGTCCCTGGGGAGAGG - Intergenic
1202805304 11_KI270721v1_random:3020-3042 GCTCCCTCGGCCCTGGCTGCGGG - Intergenic
1091412799 12:255207-255229 GCTCCCTGGACCCTGGTTGCTGG - Intronic
1091468258 12:704436-704458 AATCGCTTGAACCTGGCGGGTGG + Intergenic
1092284026 12:7118464-7118486 TCTTCCTTGACCCAGGCAGGTGG - Intergenic
1092551129 12:9501374-9501396 AATCGCTTGAACCTGGCGGGCGG - Intergenic
1093296795 12:17401029-17401051 GCTCCCTAGTCCCAGGCTGGGGG + Intergenic
1093481283 12:19606465-19606487 ACTCACTTGAACCTGGCAGGTGG - Intronic
1094520675 12:31184982-31185004 AATCGCTTGAACCTGGCGGGCGG + Intergenic
1095507235 12:42910729-42910751 GATCCCTTGAGCCTGGGAGGTGG - Intergenic
1096103962 12:48985961-48985983 CCTCCCTGGGCCCTGGCTGGAGG + Intergenic
1096356044 12:50941973-50941995 CATCCCTTGAGCCTGGAGGGTGG - Intergenic
1096987045 12:55766707-55766729 GCTCCCTTGAGCCTGGGAGGTGG - Intronic
1097235591 12:57537245-57537267 GGTCACTTGAGCCTGGCAGGTGG + Intronic
1097870930 12:64601724-64601746 GGTCCCTTGACCCTGGGAGGGGG + Intergenic
1097877280 12:64654776-64654798 GATCCCTTGAACCTGGGAGGCGG + Intronic
1098097029 12:66969484-66969506 GATCACTTGACCCTGGGAGGTGG - Intergenic
1099106226 12:78499404-78499426 GCTCCCTTGAACCCGGGAGGTGG + Intergenic
1100298575 12:93285704-93285726 AATCCCTTGAACCTGGGGGGCGG + Intergenic
1101773462 12:107772956-107772978 GATCCCTTGAGCCTGGGAGGCGG + Intergenic
1101911779 12:108865482-108865504 GATCACTTGAGCCTGGGGGGAGG - Intronic
1102012082 12:109624991-109625013 GTCCAGTTGACCCTGGCGGGTGG + Intergenic
1102160463 12:110764575-110764597 GATCACTTGACCCTGGGAGGTGG - Intergenic
1102859537 12:116323408-116323430 GATCGCTTGAACCTGGCAGGTGG + Intergenic
1103184439 12:118944262-118944284 GATCACTTGAGCCTGGGGGGTGG - Intergenic
1103338696 12:120209718-120209740 GATCCCTTGAACCTGGGAGGTGG + Intergenic
1103769667 12:123311820-123311842 GATCCCTTGAGCCTGGGAGGCGG - Intronic
1104216116 12:126735626-126735648 GCTCCCATGACCCTTGTAGGAGG - Intergenic
1104514424 12:129411453-129411475 GATCCCTTGAACCTGGAAGGTGG - Intronic
1105977630 13:25486877-25486899 GATCGCTTGAGCCTGGGGGGTGG + Intronic
1107348577 13:39489639-39489661 GATCCCTTGAGCCTGGGAGGTGG - Intronic
1107536703 13:41342222-41342244 GCTCGCTTGAACCTGGGAGGCGG - Intronic
1108194171 13:47975245-47975267 AATCCCTTGAACCTGGGGGGCGG - Intronic
1112034595 13:95485387-95485409 GCTGCCTTGACCATGGAGGCTGG - Intronic
1112346603 13:98595183-98595205 GATCCCTTGAGCCTGGGAGGTGG + Intergenic
1114641759 14:24228007-24228029 GATCCCTTGAGCCTGGGAGGTGG + Intronic
1114762345 14:25330211-25330233 CCTTCCTTGACCCTGGCAGCAGG - Intergenic
1115128633 14:30026211-30026233 GATCGCTTGAGCCTGGAGGGTGG + Intronic
1116847728 14:49880332-49880354 ACTCGCTTGAACCTGGGGGGCGG + Intergenic
1117354329 14:54909101-54909123 ACTCCCTTGAGCCTGGGAGGCGG + Intergenic
1117530109 14:56652409-56652431 GGTCCCTTGAGCCTGGGAGGTGG + Intronic
1118207773 14:63739141-63739163 GATCCCTTGAACCTGGGAGGTGG - Intergenic
1118841015 14:69511634-69511656 GATCCCTTGAACCTGGCAGGAGG - Intronic
1119492224 14:75045241-75045263 GATCCCTTGAACCTGGGAGGCGG + Intronic
1119520177 14:75279215-75279237 GCTCCCTTGTGCCTGGAGGGAGG + Intronic
1119705817 14:76781979-76782001 GCTCCTTTGCCCCTGGAGGTGGG + Exonic
1119813144 14:77541113-77541135 GATCACTTGAGCCTGGCAGGCGG - Intronic
1119868080 14:77990788-77990810 GCTTCCTTGACCCTGTTGTGTGG - Intergenic
1121475391 14:94196397-94196419 AATCACTTGAACCTGGCGGGTGG - Intronic
1122263766 14:100537474-100537496 GCTCCCTTGTCACTGGCTTGCGG + Exonic
1122955205 14:105067217-105067239 GCTCCCCTGCCCCTGCCAGGTGG + Intergenic
1202904112 14_GL000194v1_random:58851-58873 ACTCCCCTGGCCCTGGTGGGCGG - Intergenic
1123685406 15:22793525-22793547 GATCCCTTGAACCTGGCAGGTGG - Intronic
1128500887 15:68227122-68227144 GATCCCTTGAGCCTGGGAGGCGG - Intronic
1128587783 15:68866086-68866108 TCTCCCTCAACCCTGGCGGTAGG - Intronic
1129172732 15:73817867-73817889 GCTCCCCTGCCCTTGGCGGGAGG + Intergenic
1129319342 15:74765481-74765503 GATCGCTTGAACCTGGCAGGTGG - Intergenic
1129517339 15:76164827-76164849 GCTCCCTTCTCCCTGGCTGGCGG + Intronic
1129846796 15:78771555-78771577 CCTCCCGTGGCCCAGGCGGGGGG - Intronic
1129997741 15:80021305-80021327 GATCCCTTGAGCCTGGGAGGTGG + Intergenic
1130213709 15:81949191-81949213 ACTCCCTTGAACCTGGGAGGTGG + Intergenic
1131154023 15:90063812-90063834 GCGCCCTTGAGGTTGGCGGGAGG + Intronic
1131353725 15:91724784-91724806 GATCCCTTGAGCCTGGGAGGTGG - Intergenic
1132608819 16:805002-805024 GATCCCTTGAGCCTGGAAGGTGG + Intergenic
1133018842 16:2957118-2957140 AATCCCTTGACCCTGGGAGGCGG - Intergenic
1133334495 16:4998090-4998112 AATCGCTTGAACCTGGCGGGGGG - Intronic
1133505612 16:6409379-6409401 GCTCCCGTTGCCCTGGCTGGAGG - Intronic
1133558289 16:6926218-6926240 ACTCCCTTGAACCTGGGAGGGGG + Intronic
1134199100 16:12182845-12182867 ACTCCCTTGAACCTGGGAGGCGG + Intronic
1134475565 16:14570561-14570583 GATCCCTTGAACCTGGGAGGCGG + Intronic
1134908852 16:18005708-18005730 GATCCCTTGAACCTGGGAGGTGG + Intergenic
1135735766 16:24930954-24930976 GCTCCTCAGACCCTGGCAGGGGG - Exonic
1135884749 16:26295719-26295741 GCGGCCTTGGCTCTGGCGGGAGG + Intergenic
1136065523 16:27755718-27755740 GCTCTCTTGAACCTGGGAGGCGG - Intronic
1136112000 16:28069329-28069351 GCTCACTTGAGCCTGGGAGGTGG + Intergenic
1136427332 16:30177702-30177724 GCTCACTTGAGCCTGGGAGGTGG + Intergenic
1136627392 16:31470466-31470488 AATCCCTTGAACCTGGCAGGTGG - Intergenic
1138705742 16:58913335-58913357 GATCGCTTGAGCCTGGGGGGTGG - Intergenic
1141439109 16:84017872-84017894 GGTCCCATGACCCTGGCAGTGGG + Intronic
1141571240 16:84934892-84934914 GATCCCTTGAGCCTGGGAGGTGG - Intergenic
1141700569 16:85640249-85640271 GCTCCCTTAACACCGGCCGGGGG + Intronic
1142002345 16:87670972-87670994 GCTACCCTCACCTTGGCGGGAGG - Intronic
1142042978 16:87907129-87907151 AATCGCTTGAACCTGGCGGGTGG + Intronic
1142230772 16:88899273-88899295 GCACCCCTGCCCCTGGCTGGTGG - Intronic
1142510611 17:390262-390284 GATCGCTTGAACCTGGCGGGTGG + Intergenic
1142691322 17:1607530-1607552 ACTCCCTCCACCCTGGGGGGAGG + Intronic
1143104562 17:4522504-4522526 GCTCCCCTGAACCTGGCTGGAGG - Intronic
1143545252 17:7591610-7591632 GCTCCCCTTACCCTGGGGGTAGG + Exonic
1143882648 17:10041463-10041485 GGTCCCTTGCCCTTGGCTGGGGG - Intronic
1144170713 17:12657309-12657331 GATCCCTTGAGCCTAGGGGGTGG + Intergenic
1144852673 17:18251894-18251916 GCTTTCTGGACCCTGGTGGGTGG - Intronic
1145257918 17:21337698-21337720 GCTCCCATGAGCCTGCAGGGAGG + Intergenic
1145318716 17:21750308-21750330 GCTCCCATGAGCCTGCAGGGAGG - Intergenic
1145792485 17:27636554-27636576 GATCCCTTGAGCCTGGGAGGTGG - Intronic
1146844342 17:36173842-36173864 GCTCCCTTGACCCTGGCGGGGGG - Intronic
1146856647 17:36261777-36261799 GCTCCCTTGACCCTGGCGGGGGG - Intronic
1146863970 17:36326598-36326620 GCTCCCTTGACCCTGGCGGGGGG + Intronic
1146872557 17:36385688-36385710 GCTCCCTTGACCCTGGCGGGGGG - Intronic
1146879915 17:36436773-36436795 GCTCCCTTGACCCTGGCGGGGGG - Intronic
1147066830 17:37927186-37927208 GCTCCCTTGACCCTGGCGGGGGG + Intronic
1147075441 17:37986312-37986334 GCTCCCTTGACCCTGGCGGGGGG - Intronic
1147078362 17:38006747-38006769 GCTCCCTTGACCCTGGCGGGGGG + Intronic
1147086966 17:38065858-38065880 GCTCCCTTGACCCTGGCGGGGGG - Intronic
1147094300 17:38130682-38130704 GCTCCCTTGACCCTGGCGGGGGG + Intergenic
1147102911 17:38189821-38189843 GCTCCCTTGACCCTGGCGGGGGG - Intergenic
1147556752 17:41484528-41484550 GCACCCCTGACCCTGGCCTGAGG - Intergenic
1147709489 17:42452253-42452275 GATCCCTTGAACCTGGGAGGCGG - Intergenic
1148002795 17:44399725-44399747 GCTCCCAAGACCATGGTGGGAGG - Exonic
1148260994 17:46183451-46183473 GGTCACTTGAGCCTGGCGGGTGG + Intronic
1148581400 17:48746687-48746709 ACTCTCTTTCCCCTGGCGGGGGG - Intergenic
1148665930 17:49374826-49374848 GGTCCCTTGAACCTGGGAGGTGG + Intronic
1148961280 17:51395244-51395266 GGTCCCTTGAGCCTGGGAGGTGG + Intergenic
1149509897 17:57231693-57231715 GCTCACTTGAGCCTGGGAGGTGG + Intergenic
1150068702 17:62133968-62133990 GATCGCTTGAACCTGGGGGGCGG - Intergenic
1150317487 17:64181602-64181624 CCTCCCTTGAACCTGGGAGGCGG - Intronic
1151299375 17:73211479-73211501 GATCGCTTGAACCTGGGGGGTGG + Intronic
1151548030 17:74805389-74805411 CCTCCCATGTCCCTAGCGGGTGG + Intronic
1152637950 17:81437872-81437894 CCTCCCCCGACCCTGGCTGGAGG - Intronic
1153169893 18:2303638-2303660 GATCCCTTGAGCCTGGGAGGTGG + Intergenic
1155297891 18:24401980-24402002 GATCACTTGAACCTGGCAGGTGG + Intergenic
1157132512 18:45020171-45020193 GATCCCTTGAACCTGGGAGGTGG + Intronic
1158505325 18:58042608-58042630 GATCCCTTGAACCTGGGAGGCGG - Intergenic
1159165357 18:64691943-64691965 AATCGCTTGAACCTGGCGGGTGG - Intergenic
1159312164 18:66723349-66723371 GATCCCTTGAACCTGGGAGGGGG - Intergenic
1159427855 18:68312026-68312048 AATCGCTTGAACCTGGCGGGTGG + Intergenic
1160459466 18:79026832-79026854 GCCCCCTTGTTCCTGCCGGGTGG - Intergenic
1160583383 18:79900135-79900157 GCTCCCTCCTCCCTGGCTGGAGG - Intronic
1160698115 19:494375-494397 GGGCCCTTAACCCGGGCGGGGGG - Intronic
1160830802 19:1104219-1104241 GCTCCAGTGACCTTGGTGGGGGG + Intronic
1161007353 19:1943175-1943197 GTTCCCTTCACCCCGGTGGGAGG + Intronic
1161532343 19:4797542-4797564 GCTCCCTTGAGACTGGGGTGGGG + Exonic
1161631983 19:5361789-5361811 GATCACTTGAGCCTGGCGAGTGG + Intergenic
1162106608 19:8373686-8373708 TCTCCCCTGACCCCGGCAGGAGG + Exonic
1162743927 19:12788842-12788864 TCTCCCTTGAGCCTGGGGAGGGG + Intronic
1162744936 19:12792868-12792890 GCTCCCTGGACCCCAGTGGGAGG - Exonic
1163245542 19:16091686-16091708 GATCACTTGAGCCTGGAGGGCGG + Intronic
1163407286 19:17130695-17130717 GATCGCTTGAACCTGGGGGGCGG + Intronic
1163514138 19:17752993-17753015 GCTCCCTTGAGCCTGGGAGGTGG + Intronic
1163800310 19:19360985-19361007 GATCCCTTGAGCCTGGGAGGTGG - Intergenic
1165113312 19:33514384-33514406 GCTCATGTGACCCTGGCAGGAGG - Intronic
1165654525 19:37521520-37521542 GATCCCTTGAACCTGGGAGGTGG - Intronic
1165986819 19:39776792-39776814 GATCCCTTGAGCCTGGGAGGCGG + Intronic
1166710199 19:44931949-44931971 ACTCCCTTGAACCTGGGAGGCGG - Intergenic
1166801294 19:45458961-45458983 GATCCCTTGAGCCTGGGAGGTGG + Intronic
1166845743 19:45727160-45727182 GATCCCTTGATCCTGGGAGGTGG + Intronic
1166875986 19:45897640-45897662 GATCCCTTGAACCTGGGAGGCGG - Intronic
1167016095 19:46842092-46842114 GATCCCTTGAGCCTGGGAGGCGG + Intronic
1167023518 19:46896978-46897000 GATCCCTTGAGCCTGGGAGGCGG - Intergenic
1167430851 19:49453580-49453602 GCTCCCTTGAGCCTTGGCGGTGG + Intronic
1167752022 19:51387240-51387262 GCGGCCTGGACCCTGGCCGGGGG + Exonic
1167946968 19:52995867-52995889 AATCCCTTGAACCTGGGGGGCGG + Intergenic
1168268354 19:55235923-55235945 GATCGCTTTACCCTGGGGGGCGG - Intronic
925179173 2:1805797-1805819 GATCGCTTGACCCTGGGAGGCGG + Intronic
925781747 2:7387982-7388004 GCTCCCATGACCCTGTGAGGTGG - Intergenic
926001769 2:9339090-9339112 GATCCCTTGAGCCTGGGAGGTGG + Intronic
926326096 2:11785999-11786021 GCTCTCTGGACACTGGCGTGAGG + Intronic
926629882 2:15126553-15126575 GCTCCCTTGCCCCTCGGGTGAGG - Intergenic
927720183 2:25377407-25377429 GCTCCCCTCTCCCTGGCGGGTGG + Exonic
927972924 2:27316927-27316949 GCTCCCTTCCCCCTGGCCGCTGG - Intronic
928212781 2:29335951-29335973 GATCCCTTGAACCTGGGAGGCGG + Intronic
930655694 2:54005424-54005446 GATCGCTTGAACCTGGCAGGTGG - Intronic
931650040 2:64459849-64459871 GCTACATTGGCCCTGGAGGGAGG + Exonic
932022202 2:68098755-68098777 GCTGCCTTGGCCTTGGTGGGAGG - Intronic
932087213 2:68773099-68773121 GCTCCCTTGACCCTCACAAGGGG - Intronic
933821191 2:86113716-86113738 GCTCACTTGATCCTGGGAGGTGG + Intronic
934502527 2:94871549-94871571 ACTCCCCTGGCCCTGGTGGGCGG + Exonic
936101828 2:109588578-109588600 AATCCCTTGAACCTGGGGGGCGG - Intronic
936578480 2:113674917-113674939 GCTCCGATGACCCTGGCGGATGG + Intergenic
936876372 2:117194620-117194642 GATCCCTTGACCCTAGGAGGTGG - Intergenic
937332292 2:121039042-121039064 GCTCCCTGGGTCCTGGCAGGTGG + Intergenic
937388590 2:121461765-121461787 GCTCCCTTGAACCCGGGAGGTGG - Intronic
937410237 2:121668506-121668528 AATCCCTTGAACCTGGCAGGTGG + Intergenic
937444665 2:121947498-121947520 GATCCCTTGAGCCTGGGAGGTGG + Intergenic
937843088 2:126546384-126546406 GATCCCTTGAGCCTGGGAGGTGG - Intergenic
938002190 2:127751272-127751294 GATCACTTGAGCCTGGCAGGTGG + Intronic
939924769 2:148159400-148159422 GATCCCTTGAGCCTGGGAGGTGG - Intronic
942362386 2:175185503-175185525 GATCCCTTGAGCCTGGGAGGTGG + Intergenic
945582729 2:211616197-211616219 GCTCCCTTAACCCTTGAGTGGGG + Intronic
946390159 2:219410274-219410296 AATCACTTGAACCTGGCGGGTGG - Intergenic
947524931 2:230871997-230872019 TCTCCCTTCCCCCTGGAGGGGGG - Intronic
947542587 2:230989144-230989166 GATCACTTGAACCTGGGGGGTGG + Intergenic
947629683 2:231644057-231644079 GATCCCTTGAGCCTGGGAGGTGG + Intergenic
947629865 2:231645173-231645195 AATCCCTTGAACCTGGCAGGCGG - Intergenic
947979360 2:234395935-234395957 GCTCCACTTACCCTGGCTGGGGG - Intergenic
948107410 2:235426706-235426728 GCTCGCTTGAGCCTGGAAGGCGG + Intergenic
948187876 2:236035535-236035557 GCTCGCTTGAGCCTGGGAGGTGG + Intronic
1169264406 20:4158832-4158854 GCACCTCTGATCCTGGCGGGTGG + Intronic
1169543041 20:6621333-6621355 GATCACTTGAGCCTGGAGGGTGG - Intergenic
1170345685 20:15384345-15384367 GATCCCTTGAACCTGGGGAGTGG - Intronic
1170593960 20:17791808-17791830 GATCCCTTGGGCCCGGCGGGGGG + Intergenic
1171782040 20:29427962-29427984 CCTGCCCTGCCCCTGGCGGGGGG + Intergenic
1172486261 20:35299491-35299513 GATCCCTTGAACCTGGGAGGCGG + Intergenic
1172531563 20:35634505-35634527 AATCGCTTGAACCTGGCGGGTGG + Intronic
1172869078 20:38124667-38124689 GATCCCTTGAGCCTGGGAGGTGG - Intronic
1172940603 20:38651301-38651323 GCTCCCTTGACCCTTGGGTAGGG - Intergenic
1174151735 20:48490587-48490609 CCTTCCTTGAACATGGCGGGTGG - Intergenic
1174359124 20:50016841-50016863 GATCCCTTGAACCTGGGAGGTGG - Intergenic
1174588537 20:51626968-51626990 GATCCCTTGAACCTGGGAGGCGG + Intronic
1174956734 20:55106110-55106132 GCTCCCTGGTCCCTGGCTGTAGG + Intergenic
1175901463 20:62361475-62361497 TCTCCCTGGAGCCTGGCTGGAGG - Intronic
1176267292 20:64216873-64216895 GAGCCCTTGACCCTGGGAGGTGG + Intronic
1176623480 21:9073618-9073640 ACTCCCCTGGCCCTGGTGGGCGG - Intergenic
1177171962 21:17664998-17665020 GATTCCTTGACCCTGGGAGGTGG + Intergenic
1178519115 21:33272531-33272553 GCTCGCTTGAGCCTGGGAGGTGG - Intronic
1178838546 21:36119797-36119819 GATCACTTGAGCCTGGCAGGTGG - Intergenic
1180941866 22:19664953-19664975 GAGCCATTGAACCTGGCGGGGGG - Intergenic
1181669721 22:24420464-24420486 GCTCCCTTGGGCCTGGGGGTGGG + Intronic
1182021146 22:27082594-27082616 GATCCCTTGACCATGGCAGGAGG - Intergenic
1182240129 22:28909665-28909687 GATCCCTTGAGCCTGGGTGGTGG - Intronic
1183308608 22:37097464-37097486 GCTTCTTTGGCCCTGGCAGGGGG - Intronic
1183466135 22:37981308-37981330 GCTCCCTGGACCCTGGAGGGGGG - Intronic
1184091445 22:42295034-42295056 GGTCCCTTGCCCATGGCTGGTGG - Intronic
1184172074 22:42765727-42765749 CCTCCCTTCCCCCTGGAGGGAGG + Intergenic
1184389614 22:44195730-44195752 GCTCCCGTGGCCCTGGGGAGTGG + Intronic
1184861448 22:47175275-47175297 GAACCCTTGACCCTGGGGTGGGG - Exonic
1185325672 22:50224829-50224851 GATCCCTTGAGCCTGGGAGGTGG + Intronic
1185389797 22:50553113-50553135 GATCCCTTGAGCCTGGGAGGTGG + Intronic
949398309 3:3638476-3638498 GATCCCTTGAGCCTGGGAGGTGG - Intergenic
949520140 3:4844205-4844227 GATCACTTGATCCTGGCAGGTGG - Intronic
950004839 3:9685031-9685053 GCTCCCTTGACAGGGGCTGGAGG + Intronic
950133427 3:10563532-10563554 GCTTCCTTGCACCTGGAGGGTGG + Intronic
950617337 3:14171734-14171756 GCTCACTTGAACCTGGGAGGCGG + Intronic
951915186 3:27793184-27793206 GCTCCCAGCACCCTGGTGGGAGG + Intergenic
952411202 3:33051516-33051538 GATCCCTTGAACCTGGGAGGTGG + Intronic
953332785 3:42068070-42068092 GATCCCTTGAACCTGGGAGGCGG + Intronic
953467621 3:43137566-43137588 GATCCCTTGAGCCTGGGAGGCGG - Intergenic
954758205 3:52854365-52854387 CCTCCCTTCTCCCTGGAGGGTGG - Intronic
955699002 3:61664742-61664764 GCTCCCTTGAGCCTGGGAGGCGG + Intronic
956376708 3:68620802-68620824 GATCCCTTGAACCTGGGAGGTGG - Intergenic
960722255 3:120636191-120636213 GATCACTTGAGCCTGGGGGGTGG + Intronic
961265112 3:125635280-125635302 GATCACTTGACCCTGGGTGGAGG - Intergenic
961679125 3:128586986-128587008 AATCACTTGAACCTGGCGGGTGG + Intergenic
961864501 3:129943854-129943876 GATCCCTTGAGCCTGGAAGGCGG - Intergenic
963170274 3:142243235-142243257 GTACCCCTGACCCTGGCTGGTGG - Intergenic
963194050 3:142506598-142506620 GATCCCTTGAGCCTGGGAGGTGG + Intronic
963678140 3:148340102-148340124 GCTCCCTTGAGTCTGGGAGGTGG + Intergenic
963725561 3:148916498-148916520 GATCCCTTGAGCCTGGGAGGTGG + Intergenic
965344917 3:167536591-167536613 GATCACTTGAACCTGGCAGGTGG + Intronic
966411401 3:179649937-179649959 ACTCGCTTGAACCTGGGGGGCGG - Intergenic
966631813 3:182084442-182084464 ACTCCCTTGAACCTGGGAGGTGG + Intergenic
966857462 3:184204886-184204908 GATCGCTTGAACCTGGTGGGTGG + Intronic
967875971 3:194268663-194268685 GATCCCTTGAACCTGGGGGTTGG - Intergenic
968113595 3:196070853-196070875 GCTCACTTGAGCCTGGGTGGTGG + Intronic
968272749 3:197417051-197417073 AATCCCTTGAACCTGGCAGGTGG + Intergenic
969321724 4:6416865-6416887 TCTCCCTTCCCCCTGTCGGGGGG + Intronic
969383783 4:6828285-6828307 GATCGCTTGAGCCTGGGGGGTGG + Intronic
969394885 4:6914051-6914073 GCTCACTTGAGCCTGGGAGGTGG + Intronic
970388237 4:15578710-15578732 GCTCACTTGAGCCTGGGAGGCGG - Intronic
973734128 4:53853592-53853614 ACTCCCTTGAACCTGGGAGGTGG - Intronic
974957912 4:68665963-68665985 GATCGCTTGAACCTGGGGGGTGG + Intronic
980939602 4:139261001-139261023 AATCCCTTGAACCTGGGGGGAGG + Intergenic
981933979 4:150219115-150219137 GATCCCTTGAGCCTGGGAGGTGG + Intronic
982712176 4:158768865-158768887 GCTCACGTAACCCCGGCGGGAGG - Intergenic
982977948 4:162090730-162090752 GATCCCTTGAACCTGGGAGGTGG + Intronic
983836609 4:172394516-172394538 AATCCCTTGAACCTGGCAGGCGG - Intronic
984029192 4:174582393-174582415 GATCACTTGAGCCTGGCGGGTGG - Intergenic
984652950 4:182289141-182289163 GATCACTTGAGCCTGGCAGGCGG + Intronic
984804497 4:183738701-183738723 GATCGCTTGAACCTGGTGGGCGG - Intergenic
984848327 4:184127668-184127690 AATCCCTTGAACCTGGTGGGTGG + Intronic
985784824 5:1887988-1888010 CCTCCCCTAACCCTGGCGGCTGG - Intergenic
987339036 5:16922942-16922964 GATCCCTTGAGCCTGGGAGGTGG + Intronic
988036633 5:25835431-25835453 GCTCGCTTGAACCTGGGAGGTGG - Intergenic
988132533 5:27122645-27122667 GATCCCTTGAACCTGGGAGGTGG - Intergenic
989520540 5:42396042-42396064 GCTGCCATGACCCTGGCTGCAGG + Intergenic
990427921 5:55707026-55707048 GATAGCTTGAGCCTGGCGGGAGG - Intronic
990449009 5:55918186-55918208 ACTCCCTTGACCTTTGTGGGAGG + Intronic
992746099 5:79822378-79822400 GCTCACTTGAACCTGGGAGGTGG - Intergenic
993572200 5:89555105-89555127 GATCCCTTGAACCTGGGAGGTGG + Intergenic
993698928 5:91095284-91095306 GCTCTCTTGAGCCTGGGAGGTGG - Intronic
994508667 5:100675163-100675185 GCTCGCTTGAGCCTGGAAGGCGG - Intergenic
998003513 5:138642382-138642404 AATCGCTTGAACCTGGCGGGCGG + Intronic
998015697 5:138730270-138730292 AATCTCTTGAACCTGGCGGGTGG + Intronic
999112003 5:149129693-149129715 GCTTCCTTGAACCTGGTAGGTGG - Intergenic
1001862884 5:175074066-175074088 AATCACTTGAACCTGGCGGGAGG + Intergenic
1002578885 5:180195193-180195215 GCTCCAGGGACGCTGGCGGGAGG - Intronic
1004351127 6:14891424-14891446 GATCACTTGACCCTGGGAGGTGG - Intergenic
1005013492 6:21357355-21357377 CCTCCCTGGATCCTGACGGGGGG + Intergenic
1007096209 6:39214764-39214786 GCTCCCCTGACCCTGGCCTGGGG - Intronic
1007534589 6:42574780-42574802 GATCACTTGAACCTGGCAGGTGG - Intronic
1008608034 6:53159224-53159246 GCTCCCCAGACCCTTGCAGGAGG - Intergenic
1009160456 6:60276185-60276207 GATCCCTTGAACCTGGGAGGTGG - Intergenic
1011483695 6:87820218-87820240 GTTCCCTTGAGCCTGGGAGGCGG - Intergenic
1011502545 6:88006932-88006954 GCTCCTTCGCCCCTGGAGGGAGG - Intergenic
1013733747 6:113202476-113202498 GATCACTTGAGCCTGGGGGGTGG + Intergenic
1014651932 6:124050504-124050526 GCTCCCTTCAGCCTGGCTTGGGG + Intronic
1015567947 6:134593221-134593243 CCTCCCGGGACCCTGGCAGGAGG - Intergenic
1015910179 6:138161862-138161884 GCGCACCTGACCCAGGCGGGCGG + Intergenic
1017271110 6:152506626-152506648 AATCCCTTGAGCCTGGGGGGTGG - Intronic
1017819607 6:158039751-158039773 GCTCCCTGCACCCTGGGGCGAGG - Intronic
1018312940 6:162529541-162529563 GCTTCCTCGAACTTGGCGGGTGG - Intronic
1018579976 6:165300572-165300594 GCTGCCATCACCCTGGCGAGTGG + Intronic
1018888928 6:167966834-167966856 GGTCTCTGGACCCTGGCGTGAGG - Intronic
1019300241 7:299392-299414 GCCCCCTTGGCCCTGGCTCGGGG - Intergenic
1019628304 7:2032665-2032687 GGTCCCTCGAGCCTGGTGGGAGG - Intronic
1019629957 7:2043746-2043768 GCTCCCTGGGGCCTGGCAGGAGG - Intronic
1020028564 7:4916983-4917005 GATCTCTTGACCCTGGGAGGTGG + Intronic
1022102293 7:27175689-27175711 GCTGCCTTGCCCCTGGCCCGTGG + Intronic
1022213416 7:28234158-28234180 GATCACTTGAGCCTGGCAGGTGG - Intergenic
1022396745 7:29994446-29994468 ACTCGCTTGAACCTGGAGGGCGG - Intergenic
1024849325 7:53692078-53692100 GCCCTCCTGACCCTGGCAGGGGG + Intergenic
1026988881 7:74571772-74571794 GATCCCTTGACCCTGGGAGTTGG + Intronic
1027269048 7:76510412-76510434 TCTCCCTTGGCCCTGGCAGTGGG + Intronic
1029534522 7:101148696-101148718 GATCGCTTGAGCCTGGCAGGTGG - Intergenic
1029689473 7:102171532-102171554 GATCCCTTGAGCCTGGGAGGTGG - Intronic
1033049978 7:137995419-137995441 AATCCCTTGAACCTGGGGGGTGG - Intronic
1033155629 7:138954680-138954702 GCTTCCGTGAGCCTGGAGGGTGG - Intronic
1034454440 7:151159169-151159191 GATCCCTTGAGCCTGGGAGGTGG - Intronic
1035072928 7:156158010-156158032 GCTCCCTCGTCTCTGCCGGGTGG - Intergenic
1035171972 7:157021890-157021912 GCTCCCAAGACCCCGGCGGGAGG - Intergenic
1035354121 7:158266867-158266889 GCTCCAGTGGCCCTGGCTGGTGG + Intronic
1035530341 8:345992-346014 GCTCACCTGACCATGGAGGGTGG - Intergenic
1035922358 8:3691278-3691300 GATCACTTGACCCTGGGAGGCGG + Intronic
1037961461 8:23101600-23101622 GGCCCCTTGGCCCTGGAGGGTGG - Intronic
1037970168 8:23165973-23165995 GCTCCCTTGGCCCTGGAGGGTGG + Intergenic
1038578824 8:28729206-28729228 GATCACTTGAGCCTGGCAGGTGG + Intronic
1038945518 8:32355370-32355392 ACTCCCTTGAACCTGGGAGGTGG + Intronic
1042942797 8:74124796-74124818 GCTGCCTTAAACCTGGCAGGAGG + Intergenic
1044363597 8:91317071-91317093 GATCACTTGAGCCTGGGGGGTGG + Intronic
1044664377 8:94620813-94620835 GATCCCTTGAGCCTGGGAGGTGG - Intergenic
1044678859 8:94756936-94756958 GATCCCTTGAACCTGGGAGGCGG + Intronic
1047733416 8:127745394-127745416 AATCCCTTGAACCTGGCAGGCGG + Intergenic
1048045294 8:130767206-130767228 GCTCCCATAATCCTGGTGGGAGG - Intergenic
1048469988 8:134697002-134697024 GATCGCTTGAACCTGGTGGGCGG - Intronic
1049060726 8:140274068-140274090 GCTCCCTTGTCCCTGAGGAGTGG - Intronic
1049099367 8:140568195-140568217 GCTCACTTGAGCCTGGGAGGTGG + Intronic
1049389492 8:142360628-142360650 GCTCCCTTCAGGCTGGTGGGGGG - Intronic
1049495913 8:142932840-142932862 GATCCCTTGAACCTGGGAGGTGG + Intergenic
1049658402 8:143808931-143808953 GCCCCCTGGACCCTGCCAGGCGG - Exonic
1049805096 8:144535107-144535129 GCCCCCCTCACCCTGGCAGGCGG - Intronic
1049833081 8:144714314-144714336 GCTCCCTCCACCCCGACGGGAGG - Intergenic
1050566524 9:6889833-6889855 GCTCCCTTTCCCCAGGAGGGAGG + Intronic
1051268511 9:15332043-15332065 GCTCGCTTGAGCCTGGGAGGTGG + Intergenic
1051647802 9:19287465-19287487 GATCACTTGAGCCTGGTGGGGGG - Intronic
1052991727 9:34522744-34522766 GCCCCCGTGCCCGTGGCGGGAGG + Intronic
1053071996 9:35107234-35107256 GATCCCTTGAGCCTGGGAGGAGG + Intronic
1054762078 9:69012892-69012914 GCTCCCCCAACCCTGGAGGGTGG + Exonic
1056168338 9:83959364-83959386 GATCCCTTGAGCCTGGGAGGCGG + Intergenic
1057233581 9:93340702-93340724 ACTCCCTTGAACCCGGGGGGTGG - Intronic
1059084115 9:111281708-111281730 GCTCACTTGAACCTGGGAGGCGG - Intergenic
1059394810 9:114027718-114027740 GCTCCCCTGGCCCAGGCAGGTGG - Intronic
1060051559 9:120382185-120382207 GCTTCCTTCACCCAGGCCGGAGG + Intergenic
1060230440 9:121821663-121821685 GCTCCCCTGACCCTGGCACCAGG + Intergenic
1060256140 9:122032879-122032901 GATCCCTTGAGCCTGGGAGGTGG - Intronic
1060427605 9:123519522-123519544 GATCACTTGAACCTGGCAGGTGG - Intronic
1060788666 9:126470486-126470508 GCACCCTGGACCCTGGAGGGAGG + Intronic
1061253012 9:129437563-129437585 ACACCCCTGACTCTGGCGGGGGG - Intergenic
1061393006 9:130328024-130328046 GGGCCCTTGCCCCTGGCTGGGGG + Intronic
1062092596 9:134686338-134686360 GCTCGTTTGACCCTGGGTGGTGG - Intronic
1062535512 9:137019507-137019529 GATCCCTTGAGCCTGGGAGGTGG - Intronic
1203746664 Un_GL000218v1:44046-44068 ACTCCCCTGGCCCTGGTGGGCGG - Intergenic
1203563439 Un_KI270744v1:75434-75456 ACTCCCCTGGCCCTGGTGGGCGG + Intergenic
1185711409 X:2306546-2306568 AATCGCTTGAACCTGGCGGGTGG - Intronic
1186556510 X:10565894-10565916 AATCACTTGACCCTGGGGGGTGG - Intronic
1186789152 X:12980305-12980327 GATCCCTTGAGCCTGGGAGGCGG - Intergenic
1186885590 X:13910112-13910134 GCTACCTCCACCCTGGAGGGTGG + Intronic
1188218667 X:27512595-27512617 AATCCCTTGAACCTGGCAGGCGG + Intergenic
1188307388 X:28574655-28574677 ACTCCCTTGAACCTGGGAGGCGG + Intergenic
1188310997 X:28616518-28616540 ACTCCCTTGAACCTGGGAGGTGG - Intronic
1189494074 X:41493508-41493530 GATCACTTGAGCCTGGCAGGTGG + Intergenic
1189974407 X:46447264-46447286 GCTCCGCTGACCCGGGAGGGCGG + Exonic
1190430728 X:50375760-50375782 TCTCCCTTGAAGCTGGTGGGAGG + Intronic
1192844725 X:74894209-74894231 GATCACTTGAGCCTGGCAGGCGG + Intronic
1193138665 X:78002154-78002176 GATCACTTGACCCTGGGAGGTGG - Intronic
1194002492 X:88449270-88449292 AATCGCTTGAACCTGGCGGGCGG - Intergenic
1194736599 X:97519810-97519832 AATCGCTTGACCCTGGGGGGAGG - Intronic
1195296419 X:103482649-103482671 GATCACTTGAGCCTGGCAGGTGG - Intergenic
1200209891 X:154342493-154342515 TCTCCCTGGACGCTGCCGGGTGG - Intergenic
1200220961 X:154389599-154389621 TCTCCCTGGACGCTGCCGGGTGG + Intergenic
1201159995 Y:11159060-11159082 ACTCCCCTGGCCCTGGTGGGTGG - Intergenic
1201223226 Y:11791163-11791185 TCTCCCTTGTGCCTGGCTGGGGG + Intergenic
1201890140 Y:18934484-18934506 GATCCCTTGAACCTGGGAGGAGG + Intergenic