ID: 1147080073

View in Genome Browser
Species Human (GRCh38)
Location 17:38014207-38014229
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 14, 1: 1, 2: 0, 3: 6, 4: 91}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147080057_1147080073 26 Left 1147080057 17:38014158-38014180 CCCGCCACGGGCACCTCGTTCTT 0: 14
1: 0
2: 1
3: 13
4: 93
Right 1147080073 17:38014207-38014229 CGGGAAGACACCTACCCTGTGGG 0: 14
1: 1
2: 0
3: 6
4: 91
1147080058_1147080073 25 Left 1147080058 17:38014159-38014181 CCGCCACGGGCACCTCGTTCTTC 0: 14
1: 0
2: 0
3: 18
4: 104
Right 1147080073 17:38014207-38014229 CGGGAAGACACCTACCCTGTGGG 0: 14
1: 1
2: 0
3: 6
4: 91
1147080059_1147080073 22 Left 1147080059 17:38014162-38014184 CCACGGGCACCTCGTTCTTCCAC 0: 14
1: 0
2: 1
3: 10
4: 107
Right 1147080073 17:38014207-38014229 CGGGAAGACACCTACCCTGTGGG 0: 14
1: 1
2: 0
3: 6
4: 91
1147080060_1147080073 13 Left 1147080060 17:38014171-38014193 CCTCGTTCTTCCACACCCTGTCC 0: 14
1: 0
2: 1
3: 34
4: 291
Right 1147080073 17:38014207-38014229 CGGGAAGACACCTACCCTGTGGG 0: 14
1: 1
2: 0
3: 6
4: 91
1147080065_1147080073 3 Left 1147080065 17:38014181-38014203 CCACACCCTGTCCTGGTGGGGCT 0: 14
1: 1
2: 1
3: 29
4: 319
Right 1147080073 17:38014207-38014229 CGGGAAGACACCTACCCTGTGGG 0: 14
1: 1
2: 0
3: 6
4: 91
1147080056_1147080073 27 Left 1147080056 17:38014157-38014179 CCCCGCCACGGGCACCTCGTTCT 0: 14
1: 0
2: 0
3: 4
4: 50
Right 1147080073 17:38014207-38014229 CGGGAAGACACCTACCCTGTGGG 0: 14
1: 1
2: 0
3: 6
4: 91
1147080067_1147080073 -3 Left 1147080067 17:38014187-38014209 CCTGTCCTGGTGGGGCTGTCCGG 0: 15
1: 0
2: 2
3: 11
4: 170
Right 1147080073 17:38014207-38014229 CGGGAAGACACCTACCCTGTGGG 0: 14
1: 1
2: 0
3: 6
4: 91
1147080070_1147080073 -8 Left 1147080070 17:38014192-38014214 CCTGGTGGGGCTGTCCGGGAAGA 0: 15
1: 0
2: 1
3: 16
4: 163
Right 1147080073 17:38014207-38014229 CGGGAAGACACCTACCCTGTGGG 0: 14
1: 1
2: 0
3: 6
4: 91
1147080066_1147080073 -2 Left 1147080066 17:38014186-38014208 CCCTGTCCTGGTGGGGCTGTCCG 0: 15
1: 1
2: 1
3: 14
4: 151
Right 1147080073 17:38014207-38014229 CGGGAAGACACCTACCCTGTGGG 0: 14
1: 1
2: 0
3: 6
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900628899 1:3623541-3623563 CGGGGAGACAGCCTCCCTGTGGG + Intergenic
906796633 1:48701281-48701303 CAGGAGAACACCCACCCTGTGGG + Intronic
910354389 1:86339505-86339527 CCAGAAGACACCTACCCTGGCGG + Intergenic
911787394 1:101968012-101968034 CAGGAAGCCACCTAGCCAGTTGG + Intronic
913251137 1:116912601-116912623 CAGGAAGACACCAACTGTGTGGG - Intronic
916032845 1:160893239-160893261 CTGGAAGACACCCCCCCAGTAGG + Intergenic
916454143 1:164953179-164953201 GGGGAAGACACTTACACTGCAGG + Intergenic
918238267 1:182600411-182600433 GGGGAAGACACGTACCCTGATGG - Exonic
921039370 1:211415628-211415650 GGGGAACTCACCTACACTGTGGG + Intergenic
921828413 1:219700118-219700140 CGGGAACACAGCTGCCCTGCAGG + Intronic
922978186 1:229802489-229802511 AGGGAAAACACCTACCATGCTGG + Intergenic
1065547349 10:26835205-26835227 GGGGAATACCCATACCCTGTTGG + Intronic
1065699491 10:28411073-28411095 CATGAAGACACCTCCACTGTTGG + Intergenic
1065972249 10:30814954-30814976 TGGGAAAACACCTTCCTTGTGGG + Intergenic
1068961341 10:62869586-62869608 AGAGAAGACACCTTCCTTGTAGG - Intronic
1069561876 10:69436259-69436281 CGGGAAGCCCCCTGCCCTGCAGG - Intergenic
1071717508 10:88112329-88112351 AGGGAACACACCTACACTGCTGG - Intergenic
1073312809 10:102556276-102556298 CTGGCAGACAGCTACCCTCTGGG + Intronic
1075274306 10:121079517-121079539 GGGTAAGCCACATACCCTGTGGG + Intergenic
1076003097 10:126927933-126927955 AGGGAAGACACCTGCCGTGCAGG + Intronic
1083713159 11:64560907-64560929 AGGGAAGAGATCTACCTTGTAGG - Intronic
1089683338 11:120131689-120131711 TGGGATGAGTCCTACCCTGTCGG + Intronic
1097987372 12:65798135-65798157 CTGGAAGAAACCAACCCTGCTGG + Intergenic
1104092898 12:125530629-125530651 AGGGAAGACTCCTTCCCTGGAGG - Intronic
1104778239 12:131403792-131403814 AGGGAACACACCCACCCTGAGGG - Intergenic
1107316596 13:39138768-39138790 CGGGAACACTTTTACCCTGTTGG - Intergenic
1108271169 13:48760904-48760926 CTGGAAGACACTTACCCAGGTGG + Intergenic
1114237686 14:20836567-20836589 CTGGAAGACCCCTACCCTGGTGG - Intergenic
1118585012 14:67344296-67344318 CGGGAAGACACCAACAAAGTTGG - Intronic
1129179963 15:73867701-73867723 CACAAATACACCTACCCTGTAGG - Intergenic
1132619102 16:856011-856033 CGGGAAGACAGAGACCCTCTGGG + Intronic
1135376630 16:21952998-21953020 CGGGATGACACCTGCACTGGAGG - Exonic
1138374697 16:56554756-56554778 AGGCAAGACACTTCCCCTGTAGG + Intergenic
1142483640 17:233421-233443 CAGGAAAACACCAGCCCTGTGGG + Intronic
1143205979 17:5139437-5139459 CGGGAAGACACGTACCCTGTGGG + Exonic
1143445420 17:7006368-7006390 TGGGAAGACACCTCGCCTTTGGG - Intronic
1143862941 17:9904600-9904622 CGGGAAGACAACGAAGCTGTGGG + Intronic
1146842627 17:36166359-36166381 CGGGAAGACACCTACCCTGTGGG - Exonic
1146854939 17:36254318-36254340 CGGGAAGACACCTACCCTGTGGG - Exonic
1146865681 17:36334058-36334080 CGGGAAGACACCTACCCTGTGGG + Exonic
1146870839 17:36378210-36378232 CGGGAAGACACCTACCCTGTGGG - Exonic
1146878198 17:36429292-36429314 CGGGAAGACACCTACCCTGTGGG - Exonic
1146882147 17:36450438-36450460 CGGGAAGACACCTACCCTGTGGG - Intergenic
1147068550 17:37934670-37934692 CGGGAAGACACCTACCCTGTGGG + Exonic
1147073723 17:37978834-37978856 CGGGAAGACACCTACCCTGTGGG - Intronic
1147080073 17:38014207-38014229 CGGGAAGACACCTACCCTGTGGG + Intronic
1147085244 17:38058372-38058394 CGGGAAGACACCTACCCTGTGGG - Exonic
1147096022 17:38138167-38138189 CGGGAAGACACCTACCCTGTGGG + Intergenic
1147101191 17:38182338-38182360 CGGGAAGACACCTACCCTGTGGG - Intergenic
1149180322 17:53928562-53928584 AGGGAAAACTTCTACCCTGTTGG - Intergenic
1149845789 17:60008844-60008866 CGGGAAGACACCTACCCTGTGGG - Intergenic
1150084137 17:62265424-62265446 CGGGAAGACACCTACCCTGTGGG - Intergenic
1151739522 17:75970460-75970482 CGGATATACACCTGCCCTGTGGG - Intronic
1153721313 18:7906212-7906234 GGGGATGACACATACACTGTAGG - Intronic
1155967975 18:32053787-32053809 TGGAAAGCCAACTACCCTGTTGG + Intronic
1159186870 18:64985728-64985750 TGGGAAGACACATATCCTTTAGG - Intergenic
1161121345 19:2528592-2528614 GGGGAAGACTCCCGCCCTGTGGG - Intronic
1162040216 19:7966414-7966436 CGGGAAAACTCCTCCCCTCTAGG + Intronic
1164306151 19:24005022-24005044 AGGGAAGACTTATACCCTGTTGG + Intergenic
1164672713 19:30082003-30082025 CTGGGAGACTCCTACCCTGGTGG - Intergenic
1166786254 19:45369093-45369115 CGGGAAGACAGTATCCCTGTTGG - Exonic
925235297 2:2272406-2272428 AGGGAAGACACCCACCCCTTGGG - Intronic
932307798 2:70716241-70716263 CTTGAGGACAGCTACCCTGTAGG + Intronic
935156263 2:100486198-100486220 AGTGAAGACAGCTAGCCTGTGGG + Intergenic
936746029 2:115577659-115577681 TGAAAAGACACCAACCCTGTGGG - Intronic
937699119 2:124843623-124843645 AGGGAACACTCCTACACTGTTGG - Intronic
938553871 2:132405585-132405607 AGGGAAGCCTCCTACACTGTTGG - Intergenic
941212015 2:162651817-162651839 AGGGAACACTTCTACCCTGTTGG - Intronic
947108099 2:226689078-226689100 CGGGAACACTTCTACCCTGCTGG + Intergenic
1169591329 20:7146370-7146392 CGGGAAGCCAACTCCACTGTTGG - Intergenic
1171063290 20:21987481-21987503 GGTGAAGACACCTACCCAGCCGG + Intergenic
1175627888 20:60504119-60504141 GGGGAAGACACCTACCATCCAGG - Intergenic
1178742839 21:35218921-35218943 TGTGAAGTCACCTAACCTGTCGG - Intronic
1178757147 21:35362937-35362959 CAGGAGGCCACCTCCCCTGTCGG - Intronic
1180980379 22:19875583-19875605 TGGGTGGAAACCTACCCTGTGGG - Exonic
954193243 3:48979659-48979681 GTGGAAGAAGCCTACCCTGTAGG - Intronic
961454133 3:127015959-127015981 CAGGCAGACACCTTCCCTCTCGG - Intronic
961540013 3:127592869-127592891 CTGGAAGACACCTACCGTGGTGG - Intronic
963063745 3:141246046-141246068 GGAGAAGACACCTAGCCTTTTGG + Intronic
972552192 4:40144182-40144204 CGGGCAGGCACCAACCATGTGGG - Intronic
974032397 4:56787630-56787652 AGGGAAGCCAGCTGCCCTGTAGG + Intergenic
974781288 4:66556841-66556863 CGGGAAGACATCTACTCTGGCGG + Intergenic
979294731 4:119018552-119018574 GGGGAACCCACATACCCTGTTGG - Intronic
983602661 4:169548405-169548427 CTGGGAGACACCTCCCCAGTAGG - Intronic
985535005 5:459707-459729 CCGGATGACACCAACTCTGTTGG + Intronic
999130143 5:149276303-149276325 TGGGAAAACACATACCCTGTTGG - Intronic
1002872881 6:1183275-1183297 CAGGAAGATACCTACTGTGTTGG + Intergenic
1005667470 6:28072823-28072845 CAGGCAGACACCTACCATTTAGG - Intergenic
1010858280 6:80871255-80871277 AGGGAAGACTCTTACACTGTTGG + Intergenic
1011263325 6:85490656-85490678 CGGTAAGTCACCCATCCTGTAGG + Exonic
1013119056 6:107125282-107125304 CTTGTATACACCTACCCTGTAGG - Intergenic
1013481656 6:110558180-110558202 CGGGGAGACTCATACCCTCTGGG - Intergenic
1033597456 7:142867601-142867623 TGGGAAGACAGCTCCCCTGGGGG - Exonic
1034098392 7:148430472-148430494 CAGGAAGACTCTTACACTGTTGG + Intergenic
1040276297 8:46015787-46015809 GGGTAAGACACATACCCTGGGGG + Intergenic
1042170557 8:65986721-65986743 AGGGAACACACGTACACTGTTGG + Intergenic
1048674244 8:136759547-136759569 GGGGAAGACACCATCCATGTGGG + Intergenic
1056606438 9:88089672-88089694 CGGGAGGACACTTACTCTGGAGG - Intergenic
1057168239 9:92945025-92945047 TGGGAAGTCACCTGCCATGTGGG + Intergenic
1059660519 9:116395597-116395619 GGGGAAGACACTCACTCTGTTGG + Intronic
1060934597 9:127507852-127507874 CGGGACGGCACCCACCCTGCAGG + Exonic
1061025472 9:128045963-128045985 CTGGAACTCACATACCCTGTTGG + Intergenic
1062484475 9:136768226-136768248 TGGGAAGCCCCCTGCCCTGTGGG - Intergenic
1191210618 X:57881353-57881375 GGGGAACGCACCTACACTGTTGG + Intergenic
1193306160 X:79954826-79954848 AGGGAATTCACCTACACTGTTGG + Intergenic
1193412528 X:81182061-81182083 CGGGAACCCACATACACTGTTGG - Intronic
1194218352 X:91160773-91160795 AGGGAAGCCTCCTACACTGTTGG - Intergenic
1195385397 X:104309375-104309397 CGGGAAGACACTGCCCCTGCTGG - Intergenic
1196388972 X:115189978-115190000 CGGGAAGGCACCGACTGTGTCGG + Exonic
1196994694 X:121369362-121369384 AGGGAAGACTCCCACTCTGTTGG + Intergenic
1198700327 X:139390584-139390606 CCGGAAGACGCATACCCTATAGG + Intergenic
1200554865 Y:4624561-4624583 AGGGAAGCCTCCTACACTGTTGG - Intergenic