ID: 1147093811

View in Genome Browser
Species Human (GRCh38)
Location 17:38128592-38128614
Sequence CTGCTGCCCTTGGGCAGCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147093805_1147093811 -6 Left 1147093805 17:38128575-38128597 CCCTTGTCCGGGGGAGCCTGCTG No data
Right 1147093811 17:38128592-38128614 CTGCTGCCCTTGGGCAGCTGTGG No data
1147093798_1147093811 14 Left 1147093798 17:38128555-38128577 CCCCACTGAACACACATGGTCCC No data
Right 1147093811 17:38128592-38128614 CTGCTGCCCTTGGGCAGCTGTGG No data
1147093800_1147093811 12 Left 1147093800 17:38128557-38128579 CCACTGAACACACATGGTCCCTT No data
Right 1147093811 17:38128592-38128614 CTGCTGCCCTTGGGCAGCTGTGG No data
1147093806_1147093811 -7 Left 1147093806 17:38128576-38128598 CCTTGTCCGGGGGAGCCTGCTGC No data
Right 1147093811 17:38128592-38128614 CTGCTGCCCTTGGGCAGCTGTGG No data
1147093799_1147093811 13 Left 1147093799 17:38128556-38128578 CCCACTGAACACACATGGTCCCT No data
Right 1147093811 17:38128592-38128614 CTGCTGCCCTTGGGCAGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147093811 Original CRISPR CTGCTGCCCTTGGGCAGCTG TGG Intergenic
No off target data available for this crispr