ID: 1147094300

View in Genome Browser
Species Human (GRCh38)
Location 17:38130682-38130704
Sequence GCTCCCTTGACCCTGGCGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147094286_1147094300 17 Left 1147094286 17:38130642-38130664 CCTGGTGCAGCCAGAGTACACCG No data
Right 1147094300 17:38130682-38130704 GCTCCCTTGACCCTGGCGGGGGG No data
1147094294_1147094300 -3 Left 1147094294 17:38130662-38130684 CCGGGCAGGTCTCAGGGCAGGCT No data
Right 1147094300 17:38130682-38130704 GCTCCCTTGACCCTGGCGGGGGG No data
1147094290_1147094300 7 Left 1147094290 17:38130652-38130674 CCAGAGTACACCGGGCAGGTCTC No data
Right 1147094300 17:38130682-38130704 GCTCCCTTGACCCTGGCGGGGGG No data
1147094284_1147094300 19 Left 1147094284 17:38130640-38130662 CCCCTGGTGCAGCCAGAGTACAC No data
Right 1147094300 17:38130682-38130704 GCTCCCTTGACCCTGGCGGGGGG No data
1147094285_1147094300 18 Left 1147094285 17:38130641-38130663 CCCTGGTGCAGCCAGAGTACACC No data
Right 1147094300 17:38130682-38130704 GCTCCCTTGACCCTGGCGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147094300 Original CRISPR GCTCCCTTGACCCTGGCGGG GGG Intergenic
No off target data available for this crispr