ID: 1147094935

View in Genome Browser
Species Human (GRCh38)
Location 17:38133567-38133589
Sequence CCTTCATCCTCCAAGTCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147094935_1147094940 -6 Left 1147094935 17:38133567-38133589 CCTGGAGACTTGGAGGATGAAGG No data
Right 1147094940 17:38133584-38133606 TGAAGGAGTCGCCCCAGGAGGGG No data
1147094935_1147094945 6 Left 1147094935 17:38133567-38133589 CCTGGAGACTTGGAGGATGAAGG No data
Right 1147094945 17:38133596-38133618 CCCAGGAGGGGCTGGAGCGGTGG No data
1147094935_1147094948 11 Left 1147094935 17:38133567-38133589 CCTGGAGACTTGGAGGATGAAGG No data
Right 1147094948 17:38133601-38133623 GAGGGGCTGGAGCGGTGGCCGGG No data
1147094935_1147094939 -7 Left 1147094935 17:38133567-38133589 CCTGGAGACTTGGAGGATGAAGG No data
Right 1147094939 17:38133583-38133605 ATGAAGGAGTCGCCCCAGGAGGG No data
1147094935_1147094949 27 Left 1147094935 17:38133567-38133589 CCTGGAGACTTGGAGGATGAAGG No data
Right 1147094949 17:38133617-38133639 GGCCGGGAGACTCTGCACATTGG No data
1147094935_1147094947 10 Left 1147094935 17:38133567-38133589 CCTGGAGACTTGGAGGATGAAGG No data
Right 1147094947 17:38133600-38133622 GGAGGGGCTGGAGCGGTGGCCGG No data
1147094935_1147094938 -8 Left 1147094935 17:38133567-38133589 CCTGGAGACTTGGAGGATGAAGG No data
Right 1147094938 17:38133582-38133604 GATGAAGGAGTCGCCCCAGGAGG No data
1147094935_1147094942 3 Left 1147094935 17:38133567-38133589 CCTGGAGACTTGGAGGATGAAGG No data
Right 1147094942 17:38133593-38133615 CGCCCCAGGAGGGGCTGGAGCGG No data
1147094935_1147094941 -2 Left 1147094935 17:38133567-38133589 CCTGGAGACTTGGAGGATGAAGG No data
Right 1147094941 17:38133588-38133610 GGAGTCGCCCCAGGAGGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147094935 Original CRISPR CCTTCATCCTCCAAGTCTCC AGG (reversed) Intergenic
No off target data available for this crispr