ID: 1147094938

View in Genome Browser
Species Human (GRCh38)
Location 17:38133582-38133604
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147094934_1147094938 -7 Left 1147094934 17:38133566-38133588 CCCTGGAGACTTGGAGGATGAAG No data
Right 1147094938 17:38133582-38133604 GATGAAGGAGTCGCCCCAGGAGG No data
1147094935_1147094938 -8 Left 1147094935 17:38133567-38133589 CCTGGAGACTTGGAGGATGAAGG No data
Right 1147094938 17:38133582-38133604 GATGAAGGAGTCGCCCCAGGAGG No data
1147094933_1147094938 -4 Left 1147094933 17:38133563-38133585 CCACCCTGGAGACTTGGAGGATG No data
Right 1147094938 17:38133582-38133604 GATGAAGGAGTCGCCCCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147094938 Original CRISPR GATGAAGGAGTCGCCCCAGG AGG Intergenic