ID: 1147096022

View in Genome Browser
Species Human (GRCh38)
Location 17:38138167-38138189
Sequence CGGGAAGACACCTACCCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147096006_1147096022 26 Left 1147096006 17:38138118-38138140 CCCGCCACGGGCACCTCGTTCTT No data
Right 1147096022 17:38138167-38138189 CGGGAAGACACCTACCCTGTGGG No data
1147096009_1147096022 13 Left 1147096009 17:38138131-38138153 CCTCGTTCTTCCACACCCTGTCC No data
Right 1147096022 17:38138167-38138189 CGGGAAGACACCTACCCTGTGGG No data
1147096014_1147096022 3 Left 1147096014 17:38138141-38138163 CCACACCCTGTCCTGGTGGGGCT No data
Right 1147096022 17:38138167-38138189 CGGGAAGACACCTACCCTGTGGG No data
1147096015_1147096022 -2 Left 1147096015 17:38138146-38138168 CCCTGTCCTGGTGGGGCTGTCCG No data
Right 1147096022 17:38138167-38138189 CGGGAAGACACCTACCCTGTGGG No data
1147096005_1147096022 27 Left 1147096005 17:38138117-38138139 CCCCGCCACGGGCACCTCGTTCT No data
Right 1147096022 17:38138167-38138189 CGGGAAGACACCTACCCTGTGGG No data
1147096007_1147096022 25 Left 1147096007 17:38138119-38138141 CCGCCACGGGCACCTCGTTCTTC No data
Right 1147096022 17:38138167-38138189 CGGGAAGACACCTACCCTGTGGG No data
1147096008_1147096022 22 Left 1147096008 17:38138122-38138144 CCACGGGCACCTCGTTCTTCCAC No data
Right 1147096022 17:38138167-38138189 CGGGAAGACACCTACCCTGTGGG No data
1147096016_1147096022 -3 Left 1147096016 17:38138147-38138169 CCTGTCCTGGTGGGGCTGTCCGG No data
Right 1147096022 17:38138167-38138189 CGGGAAGACACCTACCCTGTGGG No data
1147096019_1147096022 -8 Left 1147096019 17:38138152-38138174 CCTGGTGGGGCTGTCCGGGAAGA No data
Right 1147096022 17:38138167-38138189 CGGGAAGACACCTACCCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147096022 Original CRISPR CGGGAAGACACCTACCCTGT GGG Intergenic
No off target data available for this crispr