ID: 1147096057

View in Genome Browser
Species Human (GRCh38)
Location 17:38138285-38138307
Sequence ACCTGGACGTAGAGGGCCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147096047_1147096057 -2 Left 1147096047 17:38138264-38138286 CCATGCCCCGCCTCCCAACGGAC No data
Right 1147096057 17:38138285-38138307 ACCTGGACGTAGAGGGCCCTTGG No data
1147096044_1147096057 22 Left 1147096044 17:38138240-38138262 CCTGGAGATTCCTGCAGTGGAAC No data
Right 1147096057 17:38138285-38138307 ACCTGGACGTAGAGGGCCCTTGG No data
1147096050_1147096057 -8 Left 1147096050 17:38138270-38138292 CCCGCCTCCCAACGGACCTGGAC No data
Right 1147096057 17:38138285-38138307 ACCTGGACGTAGAGGGCCCTTGG No data
1147096045_1147096057 12 Left 1147096045 17:38138250-38138272 CCTGCAGTGGAACTCCATGCCCC No data
Right 1147096057 17:38138285-38138307 ACCTGGACGTAGAGGGCCCTTGG No data
1147096049_1147096057 -7 Left 1147096049 17:38138269-38138291 CCCCGCCTCCCAACGGACCTGGA No data
Right 1147096057 17:38138285-38138307 ACCTGGACGTAGAGGGCCCTTGG No data
1147096051_1147096057 -9 Left 1147096051 17:38138271-38138293 CCGCCTCCCAACGGACCTGGACG No data
Right 1147096057 17:38138285-38138307 ACCTGGACGTAGAGGGCCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147096057 Original CRISPR ACCTGGACGTAGAGGGCCCT TGG Intergenic
No off target data available for this crispr