ID: 1147096081

View in Genome Browser
Species Human (GRCh38)
Location 17:38138385-38138407
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147096071_1147096081 7 Left 1147096071 17:38138355-38138377 CCAGGAGGACCAGCTGGCCCCCT No data
Right 1147096081 17:38138385-38138407 GGCTGAACACCCTGCGGAGCGGG No data
1147096070_1147096081 8 Left 1147096070 17:38138354-38138376 CCCAGGAGGACCAGCTGGCCCCC No data
Right 1147096081 17:38138385-38138407 GGCTGAACACCCTGCGGAGCGGG No data
1147096075_1147096081 -10 Left 1147096075 17:38138372-38138394 CCCCCTGCTGGCAGGCTGAACAC No data
Right 1147096081 17:38138385-38138407 GGCTGAACACCCTGCGGAGCGGG No data
1147096067_1147096081 19 Left 1147096067 17:38138343-38138365 CCGTGCCATATCCCAGGAGGACC No data
Right 1147096081 17:38138385-38138407 GGCTGAACACCCTGCGGAGCGGG No data
1147096073_1147096081 -2 Left 1147096073 17:38138364-38138386 CCAGCTGGCCCCCTGCTGGCAGG No data
Right 1147096081 17:38138385-38138407 GGCTGAACACCCTGCGGAGCGGG No data
1147096068_1147096081 14 Left 1147096068 17:38138348-38138370 CCATATCCCAGGAGGACCAGCTG No data
Right 1147096081 17:38138385-38138407 GGCTGAACACCCTGCGGAGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147096081 Original CRISPR GGCTGAACACCCTGCGGAGC GGG Intergenic