ID: 1147100458

View in Genome Browser
Species Human (GRCh38)
Location 17:38178013-38178035
Sequence CTCTCCTAAGAGGAGTGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147100458_1147100462 6 Left 1147100458 17:38178013-38178035 CCTGCACACTCCTCTTAGGAGAG No data
Right 1147100462 17:38178042-38178064 AGATGGAGAAATTGCAGTTCAGG No data
1147100458_1147100463 10 Left 1147100458 17:38178013-38178035 CCTGCACACTCCTCTTAGGAGAG No data
Right 1147100463 17:38178046-38178068 GGAGAAATTGCAGTTCAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147100458 Original CRISPR CTCTCCTAAGAGGAGTGTGC AGG (reversed) Intergenic
No off target data available for this crispr