ID: 1147101131

View in Genome Browser
Species Human (GRCh38)
Location 17:38182120-38182142
Sequence GGCTGAACACCCTGCGGAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147101131_1147101139 -2 Left 1147101131 17:38182120-38182142 CCCGCTCCGCAGGGTGTTCAGCC No data
Right 1147101139 17:38182141-38182163 CCTGCCAGCAGGGGGCCAGCTGG No data
1147101131_1147101145 19 Left 1147101131 17:38182120-38182142 CCCGCTCCGCAGGGTGTTCAGCC No data
Right 1147101145 17:38182162-38182184 GGTCCTCCTGGGATATGGCACGG No data
1147101131_1147101141 7 Left 1147101131 17:38182120-38182142 CCCGCTCCGCAGGGTGTTCAGCC No data
Right 1147101141 17:38182150-38182172 AGGGGGCCAGCTGGTCCTCCTGG No data
1147101131_1147101137 -10 Left 1147101131 17:38182120-38182142 CCCGCTCCGCAGGGTGTTCAGCC No data
Right 1147101137 17:38182133-38182155 GTGTTCAGCCTGCCAGCAGGGGG No data
1147101131_1147101144 14 Left 1147101131 17:38182120-38182142 CCCGCTCCGCAGGGTGTTCAGCC No data
Right 1147101144 17:38182157-38182179 CAGCTGGTCCTCCTGGGATATGG No data
1147101131_1147101142 8 Left 1147101131 17:38182120-38182142 CCCGCTCCGCAGGGTGTTCAGCC No data
Right 1147101142 17:38182151-38182173 GGGGGCCAGCTGGTCCTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147101131 Original CRISPR GGCTGAACACCCTGCGGAGC GGG (reversed) Intergenic
No off target data available for this crispr