ID: 1147101135

View in Genome Browser
Species Human (GRCh38)
Location 17:38182131-38182153
Sequence GGGTGTTCAGCCTGCCAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147101127_1147101135 30 Left 1147101127 17:38182078-38182100 CCTGGTCGGAATCAGTGCTGGGT No data
Right 1147101135 17:38182131-38182153 GGGTGTTCAGCCTGCCAGCAGGG No data
1147101129_1147101135 -3 Left 1147101129 17:38182111-38182133 CCGATCTCACCCGCTCCGCAGGG No data
Right 1147101135 17:38182131-38182153 GGGTGTTCAGCCTGCCAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147101135 Original CRISPR GGGTGTTCAGCCTGCCAGCA GGG Intergenic
No off target data available for this crispr