ID: 1147101156

View in Genome Browser
Species Human (GRCh38)
Location 17:38182220-38182242
Sequence ACCTGGACGTAGAGGGCCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147101156_1147101162 -9 Left 1147101156 17:38182220-38182242 CCAAGGGCCCTCTACGTCCAGGT No data
Right 1147101162 17:38182234-38182256 CGTCCAGGTCCGTTGGGAGGCGG No data
1147101156_1147101166 -2 Left 1147101156 17:38182220-38182242 CCAAGGGCCCTCTACGTCCAGGT No data
Right 1147101166 17:38182241-38182263 GTCCGTTGGGAGGCGGGGCATGG No data
1147101156_1147101164 -7 Left 1147101156 17:38182220-38182242 CCAAGGGCCCTCTACGTCCAGGT No data
Right 1147101164 17:38182236-38182258 TCCAGGTCCGTTGGGAGGCGGGG No data
1147101156_1147101168 12 Left 1147101156 17:38182220-38182242 CCAAGGGCCCTCTACGTCCAGGT No data
Right 1147101168 17:38182255-38182277 GGGGCATGGAGTTCCACTGCAGG No data
1147101156_1147101163 -8 Left 1147101156 17:38182220-38182242 CCAAGGGCCCTCTACGTCCAGGT No data
Right 1147101163 17:38182235-38182257 GTCCAGGTCCGTTGGGAGGCGGG No data
1147101156_1147101169 22 Left 1147101156 17:38182220-38182242 CCAAGGGCCCTCTACGTCCAGGT No data
Right 1147101169 17:38182265-38182287 GTTCCACTGCAGGAATCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147101156 Original CRISPR ACCTGGACGTAGAGGGCCCT TGG (reversed) Intergenic
No off target data available for this crispr