ID: 1147101191

View in Genome Browser
Species Human (GRCh38)
Location 17:38182338-38182360
Sequence CGGGAAGACACCTACCCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147101191_1147101206 25 Left 1147101191 17:38182338-38182360 CCCACAGGGTAGGTGTCTTCCCG No data
Right 1147101206 17:38182386-38182408 GAAGAACGAGGTGCCCGTGGCGG No data
1147101191_1147101197 -3 Left 1147101191 17:38182338-38182360 CCCACAGGGTAGGTGTCTTCCCG No data
Right 1147101197 17:38182358-38182380 CCGGACAGCCCCACCAGGACAGG No data
1147101191_1147101198 -2 Left 1147101191 17:38182338-38182360 CCCACAGGGTAGGTGTCTTCCCG No data
Right 1147101198 17:38182359-38182381 CGGACAGCCCCACCAGGACAGGG No data
1147101191_1147101204 13 Left 1147101191 17:38182338-38182360 CCCACAGGGTAGGTGTCTTCCCG No data
Right 1147101204 17:38182374-38182396 GGACAGGGTGTGGAAGAACGAGG No data
1147101191_1147101207 26 Left 1147101191 17:38182338-38182360 CCCACAGGGTAGGTGTCTTCCCG No data
Right 1147101207 17:38182387-38182409 AAGAACGAGGTGCCCGTGGCGGG No data
1147101191_1147101199 3 Left 1147101191 17:38182338-38182360 CCCACAGGGTAGGTGTCTTCCCG No data
Right 1147101199 17:38182364-38182386 AGCCCCACCAGGACAGGGTGTGG No data
1147101191_1147101205 22 Left 1147101191 17:38182338-38182360 CCCACAGGGTAGGTGTCTTCCCG No data
Right 1147101205 17:38182383-38182405 GTGGAAGAACGAGGTGCCCGTGG No data
1147101191_1147101194 -8 Left 1147101191 17:38182338-38182360 CCCACAGGGTAGGTGTCTTCCCG No data
Right 1147101194 17:38182353-38182375 TCTTCCCGGACAGCCCCACCAGG No data
1147101191_1147101208 27 Left 1147101191 17:38182338-38182360 CCCACAGGGTAGGTGTCTTCCCG No data
Right 1147101208 17:38182388-38182410 AGAACGAGGTGCCCGTGGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147101191 Original CRISPR CGGGAAGACACCTACCCTGT GGG (reversed) Intergenic
No off target data available for this crispr