ID: 1147101604

View in Genome Browser
Species Human (GRCh38)
Location 17:38183936-38183958
Sequence GATCCTCTGTTCTGGCCCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147101604_1147101608 7 Left 1147101604 17:38183936-38183958 CCTCTGGGCCAGAACAGAGGATC No data
Right 1147101608 17:38183966-38183988 CAGTGTGAGGAAGCTGCCCTCGG No data
1147101604_1147101611 17 Left 1147101604 17:38183936-38183958 CCTCTGGGCCAGAACAGAGGATC No data
Right 1147101611 17:38183976-38183998 AAGCTGCCCTCGGGCCAGTCGGG No data
1147101604_1147101607 -6 Left 1147101604 17:38183936-38183958 CCTCTGGGCCAGAACAGAGGATC No data
Right 1147101607 17:38183953-38183975 AGGATCATGAGGACAGTGTGAGG No data
1147101604_1147101610 16 Left 1147101604 17:38183936-38183958 CCTCTGGGCCAGAACAGAGGATC No data
Right 1147101610 17:38183975-38183997 GAAGCTGCCCTCGGGCCAGTCGG No data
1147101604_1147101609 8 Left 1147101604 17:38183936-38183958 CCTCTGGGCCAGAACAGAGGATC No data
Right 1147101609 17:38183967-38183989 AGTGTGAGGAAGCTGCCCTCGGG No data
1147101604_1147101615 30 Left 1147101604 17:38183936-38183958 CCTCTGGGCCAGAACAGAGGATC No data
Right 1147101615 17:38183989-38184011 GCCAGTCGGGGTCTGACCCCAGG No data
1147101604_1147101612 18 Left 1147101604 17:38183936-38183958 CCTCTGGGCCAGAACAGAGGATC No data
Right 1147101612 17:38183977-38183999 AGCTGCCCTCGGGCCAGTCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147101604 Original CRISPR GATCCTCTGTTCTGGCCCAG AGG (reversed) Intergenic