ID: 1147102271

View in Genome Browser
Species Human (GRCh38)
Location 17:38186921-38186943
Sequence GATGAAGGAGTCGCCCCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147102271_1147102276 -4 Left 1147102271 17:38186921-38186943 CCTCCTGGGGCGACTCCTTCATC No data
Right 1147102276 17:38186940-38186962 CATCCTCCAAGTCTCCAGGGTGG No data
1147102271_1147102274 -8 Left 1147102271 17:38186921-38186943 CCTCCTGGGGCGACTCCTTCATC No data
Right 1147102274 17:38186936-38186958 CCTTCATCCTCCAAGTCTCCAGG No data
1147102271_1147102275 -7 Left 1147102271 17:38186921-38186943 CCTCCTGGGGCGACTCCTTCATC No data
Right 1147102275 17:38186937-38186959 CTTCATCCTCCAAGTCTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147102271 Original CRISPR GATGAAGGAGTCGCCCCAGG AGG (reversed) Intergenic