ID: 1147102911

View in Genome Browser
Species Human (GRCh38)
Location 17:38189821-38189843
Sequence GCTCCCTTGACCCTGGCGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147102911_1147102925 17 Left 1147102911 17:38189821-38189843 CCCCCCGCCAGGGTCAAGGGAGC No data
Right 1147102925 17:38189861-38189883 CGGTGTACTCTGGCTGCACCAGG No data
1147102911_1147102926 18 Left 1147102911 17:38189821-38189843 CCCCCCGCCAGGGTCAAGGGAGC No data
Right 1147102926 17:38189862-38189884 GGTGTACTCTGGCTGCACCAGGG No data
1147102911_1147102921 7 Left 1147102911 17:38189821-38189843 CCCCCCGCCAGGGTCAAGGGAGC No data
Right 1147102921 17:38189851-38189873 GAGACCTGCCCGGTGTACTCTGG No data
1147102911_1147102927 19 Left 1147102911 17:38189821-38189843 CCCCCCGCCAGGGTCAAGGGAGC No data
Right 1147102927 17:38189863-38189885 GTGTACTCTGGCTGCACCAGGGG No data
1147102911_1147102917 -3 Left 1147102911 17:38189821-38189843 CCCCCCGCCAGGGTCAAGGGAGC No data
Right 1147102917 17:38189841-38189863 AGCCTGCCCTGAGACCTGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147102911 Original CRISPR GCTCCCTTGACCCTGGCGGG GGG (reversed) Intergenic
No off target data available for this crispr