ID: 1147103397

View in Genome Browser
Species Human (GRCh38)
Location 17:38191911-38191933
Sequence CTGCTGCCCTTGGGCAGCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147103397_1147103408 12 Left 1147103397 17:38191911-38191933 CCACAGCTGCCCAAGGGCAGCAG No data
Right 1147103408 17:38191946-38191968 AAGGGACCATGTGTGTTCAGTGG No data
1147103397_1147103402 -7 Left 1147103397 17:38191911-38191933 CCACAGCTGCCCAAGGGCAGCAG No data
Right 1147103402 17:38191927-38191949 GCAGCAGGCTCCCCCGGACAAGG No data
1147103397_1147103403 -6 Left 1147103397 17:38191911-38191933 CCACAGCTGCCCAAGGGCAGCAG No data
Right 1147103403 17:38191928-38191950 CAGCAGGCTCCCCCGGACAAGGG No data
1147103397_1147103410 14 Left 1147103397 17:38191911-38191933 CCACAGCTGCCCAAGGGCAGCAG No data
Right 1147103410 17:38191948-38191970 GGGACCATGTGTGTTCAGTGGGG No data
1147103397_1147103409 13 Left 1147103397 17:38191911-38191933 CCACAGCTGCCCAAGGGCAGCAG No data
Right 1147103409 17:38191947-38191969 AGGGACCATGTGTGTTCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147103397 Original CRISPR CTGCTGCCCTTGGGCAGCTG TGG (reversed) Intergenic
No off target data available for this crispr