ID: 1147110260

View in Genome Browser
Species Human (GRCh38)
Location 17:38256774-38256796
Sequence AGTCGGGGCTGGGCGGCCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147110260_1147110280 23 Left 1147110260 17:38256774-38256796 CCTGCGGCCGCCCAGCCCCGACT No data
Right 1147110280 17:38256820-38256842 CGGGCCCTGAGTCCAGCCCGCGG No data
1147110260_1147110269 3 Left 1147110260 17:38256774-38256796 CCTGCGGCCGCCCAGCCCCGACT No data
Right 1147110269 17:38256800-38256822 GGCCCGCCCGCCCTCCCGGCCGG No data
1147110260_1147110270 4 Left 1147110260 17:38256774-38256796 CCTGCGGCCGCCCAGCCCCGACT No data
Right 1147110270 17:38256801-38256823 GCCCGCCCGCCCTCCCGGCCGGG No data
1147110260_1147110281 24 Left 1147110260 17:38256774-38256796 CCTGCGGCCGCCCAGCCCCGACT No data
Right 1147110281 17:38256821-38256843 GGGCCCTGAGTCCAGCCCGCGGG No data
1147110260_1147110284 29 Left 1147110260 17:38256774-38256796 CCTGCGGCCGCCCAGCCCCGACT No data
Right 1147110284 17:38256826-38256848 CTGAGTCCAGCCCGCGGGCGCGG No data
1147110260_1147110268 -1 Left 1147110260 17:38256774-38256796 CCTGCGGCCGCCCAGCCCCGACT No data
Right 1147110268 17:38256796-38256818 TCGAGGCCCGCCCGCCCTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147110260 Original CRISPR AGTCGGGGCTGGGCGGCCGC AGG (reversed) Intergenic
No off target data available for this crispr