ID: 1147112958

View in Genome Browser
Species Human (GRCh38)
Location 17:38277451-38277473
Sequence CAGAGGAAGGAGAATGGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147112958_1147112965 -10 Left 1147112958 17:38277451-38277473 CCCACCCCATTCTCCTTCCTCTG No data
Right 1147112965 17:38277464-38277486 CCTTCCTCTGTCACAGGCTAAGG No data
1147112958_1147112967 -1 Left 1147112958 17:38277451-38277473 CCCACCCCATTCTCCTTCCTCTG No data
Right 1147112967 17:38277473-38277495 GTCACAGGCTAAGGCAGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147112958 Original CRISPR CAGAGGAAGGAGAATGGGGT GGG (reversed) Intergenic
No off target data available for this crispr