ID: 1147117785

View in Genome Browser
Species Human (GRCh38)
Location 17:38314955-38314977
Sequence CAGGAGAGACATAATGAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 429
Summary {0: 1, 1: 0, 2: 1, 3: 40, 4: 387}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147117785_1147117788 11 Left 1147117785 17:38314955-38314977 CCCACTTCATTATGTCTCTCCTG 0: 1
1: 0
2: 1
3: 40
4: 387
Right 1147117788 17:38314989-38315011 CAGATTACAGTTTTATACCTTGG 0: 1
1: 0
2: 0
3: 17
4: 176
1147117785_1147117789 12 Left 1147117785 17:38314955-38314977 CCCACTTCATTATGTCTCTCCTG 0: 1
1: 0
2: 1
3: 40
4: 387
Right 1147117789 17:38314990-38315012 AGATTACAGTTTTATACCTTGGG 0: 1
1: 0
2: 1
3: 27
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147117785 Original CRISPR CAGGAGAGACATAATGAAGT GGG (reversed) Intronic
900846171 1:5103212-5103234 CAGGAGAGACAGCATGAAGGGGG - Intergenic
901143263 1:7049415-7049437 CAAGAGACACAAAATGAAGATGG - Intronic
901347321 1:8557417-8557439 CAGGATCGACATAATGAAAATGG - Exonic
904334518 1:29787971-29787993 CAGGAGGGCCAATATGAAGTGGG - Intergenic
905503832 1:38460609-38460631 GAGGAGAGACATACTGAGGTTGG - Intergenic
906174277 1:43756605-43756627 GAGGAGAGACATAGTGAAAAGGG + Intronic
907018677 1:51043219-51043241 CAGGAGAGAGCTAGTGAAGCAGG + Intergenic
907421839 1:54352989-54353011 CAGGAGAGACAGGAGGCAGTAGG + Intronic
907422090 1:54354428-54354450 CAGGAGAGACACGAGGCAGTGGG + Intronic
907973766 1:59410951-59410973 TAGGAGAGAAAGAAAGAAGTTGG - Intronic
908129448 1:61059982-61060004 CAGAAGAGACAAATGGAAGTAGG + Intronic
908386567 1:63648273-63648295 CAGGAGAGAGAGAGTGAAGGGGG + Intronic
909372308 1:74898084-74898106 CAGGTGAGACACAATGAGGAAGG - Intergenic
909822744 1:80086631-80086653 CAGGAGAGAGTTACTGAAATCGG - Intergenic
910444033 1:87282519-87282541 CAGGAGCAACATAAGGAAGCTGG + Intergenic
910455095 1:87389394-87389416 CAGGGAAGACAGAAAGAAGTGGG + Intergenic
912372691 1:109186094-109186116 TAGGAGAGAGAGAATGAAGGAGG + Intronic
913430577 1:118786957-118786979 CAGGAGAGAGAGAGTGAAGGGGG + Intergenic
914204753 1:145517407-145517429 CAGGAGCCACATAGTGAATTGGG + Intergenic
914370808 1:147022820-147022842 CAGGAGCCACATAGTGAATTGGG - Intergenic
915608067 1:156967426-156967448 CAGGAGAGACTTCAGGAAGATGG - Intronic
915790669 1:158666852-158666874 TAGGAGAAGCATAATGAGGTTGG + Intronic
916080668 1:161229959-161229981 CAGGAGGGAAATAAGGCAGTTGG + Exonic
916421832 1:164645071-164645093 GAGCAGAGACATAAAGGAGTGGG + Intronic
916646585 1:166792618-166792640 CAGGAAAGCCATCCTGAAGTAGG + Intergenic
917766526 1:178225125-178225147 TATGAGAGACTTAGTGAAGTTGG + Intronic
918485306 1:185022466-185022488 CAAGAGAGACAGAATGAAAAGGG + Intergenic
919232529 1:194792438-194792460 CAGGAGAGAAAGAAAGAAGGAGG + Intergenic
919616635 1:199816123-199816145 CAGGAGAGAGAGAATAAAGGGGG - Intergenic
920004067 1:202819972-202819994 TAGGAGATACATAAGGAAGTAGG + Intergenic
920061379 1:203229201-203229223 CAGGACAGACAATATGAGGTTGG + Intronic
921568612 1:216751511-216751533 CAGGAGAGAAATGATGAAAGGGG - Intronic
923489320 1:234469771-234469793 TAGGAGATACACAATGAAGCTGG - Intronic
923938464 1:238792166-238792188 AAGGACAGACATAAAGAGGTGGG + Intergenic
924270045 1:242322706-242322728 CAGGAGAGAAAGAGTGAAGTAGG - Intronic
1063839960 10:10059941-10059963 CATGAAAGAGAAAATGAAGTTGG + Intergenic
1065035277 10:21631657-21631679 CAGGAGAGAGAAAATGAAGAGGG + Intronic
1065384401 10:25119924-25119946 TAGGAGAGACAGCCTGAAGTTGG + Intergenic
1065413311 10:25455025-25455047 CAGGCTAGAAATAAAGAAGTGGG - Intronic
1065765864 10:29028820-29028842 CAGTAGAGACAGAGTGAAGGGGG + Intergenic
1065995412 10:31055532-31055554 CAGGAGAGACAGAGTGAGGGGGG + Intergenic
1066627717 10:37426380-37426402 CATGAGAGAGAAAATGAACTTGG - Intergenic
1066714863 10:38276057-38276079 CAGGAGAGAGAGAGTGAAGTAGG + Intergenic
1066783215 10:38974642-38974664 CAGGAGAGAGAGAGTGAAGTAGG - Intergenic
1067559538 10:47295294-47295316 CAGGAGTGATCTAAGGAAGTGGG - Intergenic
1068082369 10:52335368-52335390 CAGGGGAGACAGGATGAAGCAGG + Intergenic
1068244270 10:54343330-54343352 CAGGAGAGAGAGAGTGAAGGGGG - Intronic
1068944740 10:62718477-62718499 CAGGAAAGAGATGCTGAAGTAGG - Intergenic
1070055072 10:72926403-72926425 CAGGTGAAAGATAATGAAGGTGG - Intronic
1071068531 10:81665847-81665869 CTGGAGAGAGAAAATGAAGAAGG + Intergenic
1071981947 10:91012351-91012373 CAGGACAGACAGATTGAAGGAGG - Intergenic
1073430030 10:103479914-103479936 AAGGAGAGACCTAGTGATGTGGG - Intergenic
1075210746 10:120489048-120489070 CTGGAGGGACAAAAGGAAGTAGG - Intronic
1076198507 10:128539334-128539356 CAAAATAGGCATAATGAAGTGGG - Intergenic
1077244566 11:1529937-1529959 CAGGAGAGCCATCATGAAAATGG - Intergenic
1078024228 11:7679546-7679568 CAGGAGAGAGAGAATGAGGGAGG - Intergenic
1080104020 11:28492863-28492885 CATCAGGTACATAATGAAGTAGG + Intergenic
1080627418 11:34043075-34043097 CAGGAGAGACAGAGTGAGGGTGG + Intergenic
1083045318 11:59729249-59729271 CAGGAGAACCACAATGAGGTGGG - Intronic
1083911582 11:65713071-65713093 CAGGAGAGAAAAGGTGAAGTGGG - Intronic
1084778926 11:71396279-71396301 CAGGACAGACATCATGAGGAAGG - Intergenic
1085494600 11:76956826-76956848 CATTAGAGAAATAAGGAAGTGGG - Intronic
1086232074 11:84581561-84581583 CATGAGAGACATTATAAAGTTGG - Intronic
1086909497 11:92456185-92456207 TAGGAGAGACCTTATGAAGTAGG - Intronic
1087021638 11:93609001-93609023 CTGGAGTAACATAATGAAATTGG + Intergenic
1087131178 11:94670681-94670703 CAGGAGAGAGAGAGTGAAGTGGG - Intergenic
1089069039 11:115684529-115684551 CAGGAGAGAAATTATGATGAGGG + Intergenic
1089270194 11:117296705-117296727 CAGGAGAGACAGGGTGAAGTGGG - Intronic
1089396295 11:118138076-118138098 GAGGAGGGACACACTGAAGTTGG - Intronic
1089910314 11:122092404-122092426 AAGGAGAGAAATAAAGAAGAAGG + Intergenic
1090035940 11:123249606-123249628 CAAGAGAGACATAATTAGCTGGG + Intergenic
1092240649 12:6834125-6834147 CAGGACAGGCAGAATGAAGGGGG - Intronic
1092888740 12:12949417-12949439 CAGGAGAAAAATCATGCAGTAGG - Intronic
1092902591 12:13073883-13073905 CACGAGGGACAAAATGATGTCGG - Intronic
1093689163 12:22090139-22090161 CAGGAGAGAGAGAGTGAAGAGGG - Intronic
1093698794 12:22194508-22194530 AAGGAAACACATAAGGAAGTAGG + Exonic
1095115014 12:38343232-38343254 CAGGTGCCACATAATGATGTCGG - Intergenic
1095562895 12:43586677-43586699 CTGGAGATACATACTGAAGCAGG + Intergenic
1096373587 12:51089071-51089093 CAGGAGAAGCAGAATGATGTAGG + Intergenic
1097288390 12:57894849-57894871 CAGGTGGGACAGAGTGAAGTGGG + Intergenic
1097389464 12:58992457-58992479 TATGAGAGACTTTATGAAGTAGG - Intergenic
1097403640 12:59161101-59161123 CAGGAGAGAGAGAGTGAAGGGGG + Intergenic
1097808204 12:63988636-63988658 TAGGAAAGAAATGATGAAGTTGG - Intronic
1098576925 12:72053067-72053089 CAGGAGAGAAAGAGTGAAGGGGG + Intronic
1099275092 12:80564868-80564890 AAGTACAGACATTATGAAGTAGG + Intronic
1099419625 12:82440834-82440856 CATCAGAGACCTATTGAAGTAGG + Intronic
1099876813 12:88418022-88418044 CAAGAGAGCCCTAATGAAGATGG - Intergenic
1100084809 12:90896753-90896775 CAGGAAAGACTTCATGGAGTGGG - Intergenic
1100096231 12:91040972-91040994 CAGGACAGACAACATTAAGTTGG - Intergenic
1100163374 12:91888129-91888151 CAAGAGAGAGATAATGAAGAAGG + Intergenic
1101443289 12:104719441-104719463 CGAGAGAGACAGAGTGAAGTGGG - Intronic
1102729168 12:115092759-115092781 CAAGTGAGACTTCATGAAGTAGG - Intergenic
1102736395 12:115164616-115164638 CAGGAGAGATAGAATGGAATGGG - Intergenic
1102858579 12:116316102-116316124 CAGCAGAGACACCAGGAAGTTGG - Intergenic
1103978549 12:124720468-124720490 CAGGAGAGAAAAAAAGCAGTCGG + Intergenic
1106690895 13:32115103-32115125 TGGGAGAGACAGCATGAAGTAGG + Intronic
1107131331 13:36899545-36899567 CAGGAGGAACTAAATGAAGTCGG + Intronic
1107676414 13:42802431-42802453 CAGGAGAGAGAGAGTGAAGGGGG - Intergenic
1108119815 13:47172426-47172448 CAGTAGAGACATTATGATGGAGG + Intergenic
1109475269 13:62873074-62873096 CAGGAGAGAGAGAATGACGGGGG - Intergenic
1109817293 13:67602051-67602073 CAGGAGAGAAAGAGTGAAGGGGG + Intergenic
1109947196 13:69451575-69451597 CAGGAAAGAAATATTGAAGGAGG + Intergenic
1110367291 13:74701269-74701291 CAGGTGAGACACAATGAATGAGG + Intergenic
1110682128 13:78326922-78326944 CAGAAGTGACAAAATGAAATAGG + Intergenic
1111082020 13:83322963-83322985 CAGAAGAGACACAAAGATGTGGG - Intergenic
1111090936 13:83446170-83446192 CAGGAGAGAGAAGATGAAGGGGG + Intergenic
1111465515 13:88603431-88603453 CAGGAGAGAAAGGATGAAATGGG - Intergenic
1111657449 13:91171545-91171567 CAGGAGAGAAAGCATGAAGGAGG + Intergenic
1111778767 13:92694998-92695020 CAGGAGAGAGAGAGTGACGTAGG - Intronic
1112512384 13:100021119-100021141 CAGGAGAGAGAGAGTGAAGGTGG - Intergenic
1113217883 13:108063417-108063439 CAGGAAAGAAAGAATGAAGGAGG + Intergenic
1113702844 13:112399904-112399926 CAGGAGAGAGAGAGTGAAGGGGG + Intronic
1114042200 14:18689388-18689410 CAGGAATGATATAATGAACTTGG + Intergenic
1115024393 14:28724504-28724526 CAAGATAGACATAATTATGTAGG + Intergenic
1119353195 14:73983295-73983317 CAGGAGAAACCTAGAGAAGTGGG + Intronic
1120015300 14:79466733-79466755 CAGGAGAGACATGATGCCTTTGG + Intronic
1120299476 14:82688166-82688188 CTGGTGAGACAGAATGAAGAAGG + Intergenic
1120792451 14:88597652-88597674 CAGGAGGCAGAGAATGAAGTTGG - Intronic
1121763169 14:96462725-96462747 CAGTAGAGACATCAACAAGTTGG - Intronic
1122765352 14:104065699-104065721 CAGGAGAGAGAGAGTGAAGGGGG + Intergenic
1123771854 15:23537079-23537101 CAGGTGAGACATAATGAGGAAGG - Intergenic
1124117551 15:26860196-26860218 CAGGAGACACATATTAGAGTGGG + Intronic
1124802980 15:32852784-32852806 CAGGAGTGACATGATCATGTTGG - Intronic
1125225502 15:37390734-37390756 CAGGAAAGACAGAATGAGGAGGG + Intergenic
1125367509 15:38933727-38933749 CATGAGAGACATAATGGTTTTGG + Intergenic
1127009541 15:54607734-54607756 CAGGAGAGACAAAGGGAAGGGGG + Intronic
1127249019 15:57210128-57210150 CAGGAGCAACATAATAAAGCAGG + Intronic
1127698401 15:61473774-61473796 CAGGAGAGAAAGAAGGAAGGAGG + Intergenic
1129291596 15:74572389-74572411 CAGGACATACATCCTGAAGTTGG - Intronic
1130057000 15:80534942-80534964 CAGGAGAGACAAGATTTAGTGGG + Intronic
1131377063 15:91934220-91934242 CAGGAGAGGAATACTGAATTGGG + Intronic
1133928619 16:10213921-10213943 CAGGAGAGGCAGGATCAAGTCGG - Intergenic
1134340204 16:13337832-13337854 CAGGAGAGAGAGAGTGAAGGGGG - Intergenic
1134845765 16:17438730-17438752 CAGGAGAGAGAGAGTGAAGGGGG + Intronic
1137706592 16:50539794-50539816 CAGAAGAAACAAAATGATGTGGG + Intergenic
1139934007 16:70554458-70554480 CACGAAAGACACAATGATGTAGG - Exonic
1140665687 16:77225132-77225154 CAGGAGAGACAGAAGGAAAATGG - Intergenic
1143390829 17:6558245-6558267 CAGCATACACATAACGAAGTGGG + Intergenic
1147117785 17:38314955-38314977 CAGGAGAGACATAATGAAGTGGG - Intronic
1147228594 17:39000799-39000821 CAGGAGAGAGAAAGTGATGTAGG - Intergenic
1148530463 17:48385429-48385451 TTGGAGAGACATAATGAAGAAGG + Intronic
1149134196 17:53345159-53345181 CAGGAGAGAGAGAGTGAAGTGGG - Intergenic
1149370765 17:55991701-55991723 CAGGAGAGACACAATCTGGTAGG + Intergenic
1149789135 17:59462037-59462059 CAGGCAAGACATAAGGAGGTAGG + Intergenic
1150236844 17:63600305-63600327 CAGCAGAGAGAAAATGAAGAGGG + Intergenic
1150440163 17:65184696-65184718 AGGGAGAGACAGAATGAAGGAGG - Intronic
1150447716 17:65240369-65240391 CAGGAGAAAGAAAATGAAGCTGG - Intergenic
1150907941 17:69358676-69358698 AAGGAGAAAAATAATTAAGTTGG + Intergenic
1151077774 17:71293971-71293993 CAGGAGAGAGAGAGTGAAGGGGG + Intergenic
1151103830 17:71588865-71588887 CAGGAGAGAGATAGAGAAGGGGG - Intergenic
1151396829 17:73828247-73828269 CAGGAGAGAAAGGATGAAGGAGG - Intergenic
1151852534 17:76699476-76699498 CAGGAAACACATTATGAAGTTGG - Intronic
1151875345 17:76864958-76864980 CAGGAGAGAAACAGTGAAGAGGG + Intergenic
1151999859 17:77638462-77638484 TAGGAGAGACGGAAAGAAGTGGG + Intergenic
1152426856 17:80222731-80222753 CAGGAGGGACATAATGGCGGTGG - Exonic
1152480754 17:80550749-80550771 CAGTGGAGACAAAATGAAGCAGG - Intronic
1154136695 18:11786002-11786024 CAGGTAAGAAATAATGAAGGAGG - Intronic
1155220460 18:23680642-23680664 AAGTAGAGACATAGGGAAGTTGG + Intergenic
1157695300 18:49717761-49717783 CAGGAGAGCCCTGAAGAAGTGGG - Intergenic
1157991327 18:52499911-52499933 TAGGAGAGACTGAATGAATTAGG + Intronic
1158009000 18:52706966-52706988 CAGGAGAGAAATGATGCAGAGGG + Intronic
1158223495 18:55175196-55175218 CAGGAGAGAGAAAGTGAAGGCGG + Intergenic
1159117964 18:64136709-64136731 CAGAAGAGACAATATGAAGAAGG + Intergenic
1159879361 18:73844098-73844120 CAGCAGTGACCTAATGAAATAGG - Intergenic
1160227306 18:77020912-77020934 CAGGAAAGTCATAAAGACGTTGG + Intronic
1161121962 19:2532528-2532550 GAGGAGAGAGAGAATGAAGCAGG + Intronic
1162581554 19:11534273-11534295 GAGCAGAGACTGAATGAAGTTGG + Intergenic
1164743656 19:30595093-30595115 CAGGAGAGGCACAATGAAGTTGG + Intronic
1164972248 19:32542560-32542582 GAGGAGAAAGAGAATGAAGTAGG + Intergenic
1165164873 19:33845452-33845474 AAGGAGATACACAATGAAGTGGG + Intergenic
1165180404 19:33962602-33962624 CAGGAGAGAGAAAGTGGAGTGGG - Intergenic
1165334309 19:35158288-35158310 AAGGAGAGAGAAAAAGAAGTGGG - Intronic
1165992156 19:39822570-39822592 CAGGAGAGACCTAAAGAGGAAGG + Intergenic
1167609078 19:50497642-50497664 GAGGAGAGACAGAGAGAAGTGGG + Intergenic
925437090 2:3847848-3847870 CAGGAGAGAGAGAGTGAAGGGGG - Intergenic
925458857 2:4042827-4042849 CAGCAGAGATGTAAGGAAGTTGG - Intergenic
925819155 2:7782722-7782744 CAGGAGAGAGAAAAAGGAGTAGG - Intergenic
926938681 2:18113100-18113122 CAGGAGAGAGTTAAGGAAGTTGG + Intronic
926949137 2:18222346-18222368 CAGAAGAGGCATCTTGAAGTTGG - Intronic
927178918 2:20430039-20430061 CAAGAGAAACATTATGTAGTAGG - Intergenic
927826476 2:26313129-26313151 CAGACGAGACAGCATGAAGTGGG + Intronic
928898863 2:36296361-36296383 CAGGAGAGAAAGAGTGAAGAGGG + Intergenic
929100878 2:38312381-38312403 CAGGAGAGAGAGAGTGAAGGGGG - Intronic
929726480 2:44434152-44434174 CAGCATACACATAATGAAGACGG - Intronic
930016398 2:46973767-46973789 CAGAAGAGACAGAAAAAAGTCGG + Intronic
931917984 2:66979996-66980018 GAGGACAGGCATAATGAAGGTGG - Intergenic
933148963 2:78891346-78891368 AAGGAGAGACAGAAGGAAGGAGG - Intergenic
933337889 2:80983689-80983711 CAGAAAAGAATTAATGAAGTGGG - Intergenic
933391432 2:81673829-81673851 CAGGAGAGACAGTCTGAAGAGGG - Intergenic
933588270 2:84203246-84203268 CAGGAGAGACAGAAAGAAAATGG + Intergenic
933591155 2:84233990-84234012 CAGTAAAAACAAAATGAAGTTGG + Intergenic
935147708 2:100407372-100407394 CAGGAGGCACATAAAGAACTGGG + Intronic
936260267 2:110953818-110953840 CAGGAGAGAGAGAGAGAAGTCGG + Intronic
937380889 2:121375200-121375222 CAGGAGAGAGAGAGTGAAGAGGG - Intronic
938982061 2:136536398-136536420 CAGGAGAGTCAGTACGAAGTGGG + Intergenic
938982549 2:136540275-136540297 CAGGAGAGAGAGCATGAAGTGGG - Intergenic
940454277 2:153875377-153875399 TAGCAAAGACATAATGAAGGTGG + Intronic
940740362 2:157500664-157500686 TAGGAGATGCATACTGAAGTAGG + Intergenic
941875426 2:170427634-170427656 AAGGAGAGGCATACTGAAATAGG - Intronic
942776991 2:179593888-179593910 CAGGAGAAAGATTATGAAGGGGG - Intronic
944307325 2:198193512-198193534 CAGGAGAGAGAGAGTGAAGGGGG + Intronic
944322598 2:198365474-198365496 AAGGAGAAAAATTATGAAGTAGG + Intronic
944635633 2:201673784-201673806 GAAGGGAGACATAATAAAGTGGG + Intronic
945591466 2:211737394-211737416 TAGGAGAGACAAGAAGAAGTGGG - Intronic
946205125 2:218100374-218100396 CAGGAGAGAGAGAGTGAAGGCGG + Intergenic
946937566 2:224737457-224737479 CAGGAGAGAGAGAGTGAAGAGGG - Intergenic
946968397 2:225065071-225065093 AAGGAGAGAGAGAGTGAAGTGGG + Intergenic
947488052 2:230570573-230570595 CAGGAGAGAAAGAGTGAAGGGGG + Intergenic
947764121 2:232624909-232624931 CAGGAGGGGCATCATGGAGTCGG - Intronic
948204381 2:236155341-236155363 AAAGAGACACATAATGAAGAGGG - Intergenic
948397097 2:237653016-237653038 CAGGAGAGAGAGAGTGAAGGGGG - Intronic
1168861125 20:1046676-1046698 CAGGAGGGACACACAGAAGTCGG + Intergenic
1169628784 20:7601377-7601399 CAGGAGAGAGAGAGTGAAGGGGG - Intergenic
1169645115 20:7801769-7801791 CATGAAAGACATAGTGTAGTGGG - Intergenic
1169683421 20:8242821-8242843 CAGGAGAGACATAATGCTTCTGG + Intronic
1171937364 20:31287708-31287730 CAGGAGAGACATCATGATGAGGG - Intergenic
1172974457 20:38895763-38895785 GAGGAGAGAAAGAAGGAAGTTGG - Intronic
1173872301 20:46349809-46349831 CAGGAGCGAGAAAATGAAGGAGG + Exonic
1174664984 20:52249543-52249565 CAGGAGAGAGAGACTGAAGGGGG - Intergenic
1175013719 20:55765836-55765858 CAGGAGAGAGAGCATGAAGGAGG + Intergenic
1175303145 20:57957113-57957135 CAGGAGAGACACTAAGGAGTTGG + Intergenic
1175303385 20:57958938-57958960 CAGGAGAGACCTTAAGGAGTTGG + Intergenic
1175452959 20:59085541-59085563 CAGCAGAGACGCAATGATGTTGG - Intergenic
1177085379 21:16696142-16696164 CAGGAGAGAGAGAGTGAAGAGGG + Intergenic
1177255835 21:18661947-18661969 CTGGAGACACGTAATGAGGTAGG - Intergenic
1177372992 21:20230468-20230490 CAGAAAAGACATAATCAAGAGGG + Intergenic
1178550802 21:33537603-33537625 TAGGAGAGATATAATTAAGGAGG + Intronic
1179620594 21:42613303-42613325 CAGGAGGAAGAGAATGAAGTTGG + Intergenic
1182692654 22:32174885-32174907 CAGGAGAGACATAACACCGTTGG - Intergenic
950680685 3:14583222-14583244 CAGGAGAGACTGACTGTAGTTGG + Intergenic
951507783 3:23467887-23467909 CAGGAGAGAGACAGTGAAGTGGG + Intronic
952011863 3:28908848-28908870 CAGGAGAGAGAAAGTGAAGGGGG - Intergenic
952121719 3:30252974-30252996 CTGAATAGACATAGTGAAGTTGG + Intergenic
955465889 3:59236926-59236948 CAGGAGAGACAGAAACAAATTGG + Intergenic
955489828 3:59471056-59471078 AAGGTGAGACATTTTGAAGTAGG + Intergenic
955966220 3:64391893-64391915 AAGGAGAGACACTAAGAAGTAGG - Intronic
955980375 3:64519303-64519325 CACCAGAGACCTAATGAAGCAGG + Intronic
956222721 3:66921869-66921891 CAGGAGAGAGAGAGTGAAGGGGG + Intergenic
957269360 3:78009342-78009364 CAGTAGATACAGAAAGAAGTAGG + Intergenic
957504427 3:81101270-81101292 CAGGAGAGAGAGAAAGAAGGGGG - Intergenic
958180159 3:90049510-90049532 CAGTAGATACCTTATGAAGTTGG + Intergenic
960216950 3:115051905-115051927 CAGGAGAGAGAAAATGAAGAGGG + Intronic
962327971 3:134451529-134451551 CAAAAGAGACAGAGTGAAGTGGG - Intergenic
962333991 3:134509268-134509290 CAGGAGAGAGAGAGTGAAGTGGG + Intronic
963590553 3:147252445-147252467 GAGGAGAGAAATAATTAAATTGG + Intergenic
964005281 3:151819579-151819601 CAGGAGAAATATAAACAAGTTGG + Intronic
964271320 3:154959358-154959380 CAGGAGAGAGAGAGTGAAGGGGG + Intergenic
964768807 3:160203432-160203454 CAGGAGAGACATATGGGAGGAGG + Intergenic
964977590 3:162638795-162638817 ATGAAGAAACATAATGAAGTTGG - Intergenic
965801416 3:172497619-172497641 GAGAAGAGACATAAGGAAGGGGG + Intergenic
965814868 3:172625872-172625894 CAGGAGAGACATCTGGAAGGAGG + Intergenic
965865209 3:173197330-173197352 CAGGAGAGAGAGAATGAAGGAGG + Intergenic
966254643 3:177904020-177904042 CAGGAGAGCTATAATTAAGGAGG + Intergenic
966477421 3:180366445-180366467 CAGGAGAGAGAGAGTGAAGGGGG + Intergenic
967491490 3:190096385-190096407 CAGGAGAGAGAAAGTGAAGGAGG - Intronic
968785919 4:2622375-2622397 CAGGACAGGCATAAGGAAGCAGG - Intronic
971344583 4:25800019-25800041 CAGGATAGACAGAAAGAAGATGG - Intronic
972113421 4:35595200-35595222 GAGAAGAGACATCCTGAAGTTGG - Intergenic
973169103 4:47116904-47116926 CAGGAGAGAGAGAAAGAAGGGGG + Intronic
974608620 4:64185366-64185388 CAGGAGAGAGAGAATGAAGGGGG + Intergenic
974649440 4:64735093-64735115 TAGGAGAGAGAAAATGAATTTGG - Intergenic
977193608 4:94030923-94030945 CAGAAGAGCTATGATGAAGTGGG - Intergenic
977401139 4:96534130-96534152 GAGGAGAGAGAGAAAGAAGTGGG - Intergenic
978314933 4:107425212-107425234 CAGGAGGGAGAGAGTGAAGTGGG + Intergenic
978321176 4:107497352-107497374 CAGGAGTGACATAAGCAAGATGG - Intergenic
978391278 4:108228119-108228141 CAGGAGAGAGAGAGTGAAGGAGG + Intergenic
978597318 4:110392313-110392335 CAGGGGAGACATTCTGAAGATGG + Intronic
979373371 4:119915482-119915504 CAGGAGAGATAAAGTGAAGGAGG + Intergenic
980383660 4:132059187-132059209 CAGGAGAGAGATAGTGAAGGGGG - Intergenic
980410546 4:132413116-132413138 CAGGAGACACAGAGTGAAGGGGG - Intergenic
980766550 4:137313710-137313732 CTGGGGAGACATAATGAACTTGG + Intergenic
980767952 4:137332536-137332558 CAAGAGAGACAGAGGGAAGTTGG + Intergenic
980890522 4:138810026-138810048 CTGGAAATACATAATGAAGTAGG + Intergenic
981157490 4:141456709-141456731 AAGGAGAGCAATAATGAAGCAGG - Intergenic
981351696 4:143737243-143737265 CAGGACAGATATAATCAAGAAGG + Intergenic
981636969 4:146892192-146892214 CAGGAGAGAGAGAATTAAGGGGG - Intronic
983866311 4:172771389-172771411 TAGGAGAGAAATAATAAACTCGG - Intronic
984444737 4:179822393-179822415 TAGGAGACACATAATATAGTTGG + Intergenic
984592494 4:181632213-181632235 CAGGAGAGAGAGAGTGGAGTGGG + Intergenic
986423643 5:7609143-7609165 CAGAAGAGACATGAAGAATTTGG - Intronic
986846551 5:11763097-11763119 CAGGAGAGAGAGAGTGAAGGAGG - Intronic
987144285 5:14976961-14976983 CAGGTGAGAGAAAATGATGTTGG - Intergenic
987516577 5:18918070-18918092 CGGGAGAGAGAGAGTGAAGTGGG - Intergenic
987671882 5:21020700-21020722 CAGGAGAGACAAAATAAATTTGG - Intergenic
987967775 5:24897650-24897672 CAGGAGAGAGAGAGTGAAGGAGG - Intergenic
988025001 5:25674140-25674162 CAGGAGAGAGAGAATGAACAGGG + Intergenic
988084987 5:26463584-26463606 CAGGAGAGAGAAAAAGAAGGAGG - Intergenic
990629051 5:57647723-57647745 CAGGAGAGAGATAGGGAAGGGGG + Intergenic
992902995 5:81317639-81317661 CAGGAGAGATAGAGTGAAGGGGG + Intergenic
993691570 5:91007404-91007426 CAGGGGAGAGAAAAGGAAGTAGG - Intronic
994053705 5:95391548-95391570 CAGAAGAAAGATAGTGAAGTAGG - Intronic
994565376 5:101439433-101439455 CAGGAGAGACAGAGTGAAGGAGG - Intergenic
994720350 5:103372921-103372943 CTTGAGAGACAGAATGAAATGGG - Intergenic
994935092 5:106244108-106244130 CAGGATATAGATAATGAATTAGG - Intergenic
996663251 5:126028056-126028078 AAGGAGGGAGATAATGAAGTTGG + Intergenic
997981883 5:138472723-138472745 CAGGACACACTTAATGCAGTTGG + Intergenic
998973130 5:147614483-147614505 CAGTAGAGATAAAAAGAAGTAGG - Intronic
999883497 5:155893556-155893578 CTAGAGAGGCATAATGAAGATGG + Intronic
1002984971 6:2180820-2180842 GAGGAAATACCTAATGAAGTAGG - Intronic
1003144335 6:3497209-3497231 AAGGAGAGACATAATAAACAGGG - Intergenic
1003219288 6:4143420-4143442 CAGGAGAGAGAGAATGAAGGGGG + Intergenic
1003415899 6:5907605-5907627 TAGGAGATACATAAGAAAGTGGG - Intergenic
1004011574 6:11693259-11693281 CAGGAGAGACATAGAGAAGGGGG - Intergenic
1004748948 6:18541049-18541071 CAGGAAAGGCTTAATGGAGTAGG + Intergenic
1004799820 6:19134228-19134250 CAGGGAAGAGATAATGAAATAGG + Intergenic
1005637234 6:27764088-27764110 AAGGTGAGACATAAGGAATTTGG + Intergenic
1005804246 6:29459470-29459492 AAGGAGAGACGTAATGATGGAGG + Intronic
1005963773 6:30712071-30712093 CAGGAGAGAGCTCATGAGGTGGG - Exonic
1006152756 6:31998079-31998101 CAAGAGACACAGAATGAAGAAGG - Intronic
1006159064 6:32030816-32030838 CAAGAGACACAGAATGAAGAAGG - Intronic
1006706097 6:36022766-36022788 CAAGAAAGACATAATGGAGCTGG - Intronic
1007068327 6:39015538-39015560 CAGGAGAGAGAGAGTGAAGGAGG - Intronic
1007814601 6:44512443-44512465 CAGAAAAGACAGAATGAAGAAGG + Intergenic
1008067416 6:47063890-47063912 CAGGAGAGAGAGAGTGAAGCGGG + Intergenic
1008798589 6:55338719-55338741 CAGAAGAAACAGAATGAAGTGGG + Intronic
1008809103 6:55470821-55470843 CAGGAGAGAGAGCATGAAGAGGG + Intronic
1009345680 6:62610952-62610974 CAGGAGAGAGAGAGTGAAGGGGG + Intergenic
1009445065 6:63732979-63733001 CAGGAAAGGCATTATGAAGAAGG + Intronic
1010383693 6:75253297-75253319 CATGATGGAAATAATGAAGTGGG - Exonic
1010635709 6:78256902-78256924 TAGGAGACATATAATGAACTTGG - Intergenic
1010659633 6:78555438-78555460 CAGGAGAGAAAGAGTGAAGGGGG + Intergenic
1010875652 6:81101956-81101978 CAGGAGAGACAGAGTGAAGGGGG - Intergenic
1011228534 6:85134497-85134519 CAGGAGAGAAAAAATGCAGCCGG + Intergenic
1011503901 6:88020261-88020283 GAGAAGAGAGATAAGGAAGTAGG - Intergenic
1011551456 6:88534575-88534597 CAGGAAAGAGAGAATGAAGGGGG + Intergenic
1012644958 6:101667052-101667074 CAGGAGAGAGTTAATGACCTGGG + Intronic
1012956803 6:105579810-105579832 CAGGAGAGAAAGAGTGAAGAGGG + Intergenic
1013236825 6:108204221-108204243 CAGGAGAGACAGAAAGAGATTGG - Intergenic
1013507961 6:110817810-110817832 CAGGGTAGACTTCATGAAGTAGG + Intronic
1014044347 6:116867094-116867116 CTTAAGAGACATAATAAAGTTGG - Intergenic
1014271073 6:119336602-119336624 CAGGAGAAACAATATGAAATTGG + Intronic
1015071796 6:129103487-129103509 CAGAAGAGAAAAAATGAAATTGG - Intronic
1015190977 6:130471881-130471903 AAGGAGAGAAAAAAGGAAGTTGG - Intergenic
1016311379 6:142737461-142737483 CAGGTGAGAAATGATGAAGCTGG + Intergenic
1016926257 6:149351430-149351452 CAGGACAGATATAATGCAATTGG + Intronic
1017168942 6:151437741-151437763 CAGGAGATACAGAATGGAGGTGG - Intronic
1017308777 6:152952586-152952608 CAATAGAAACATAAAGAAGTGGG + Intergenic
1017631825 6:156403446-156403468 CAGGAGAGAGAGAGTGAAGGGGG - Intergenic
1017754760 6:157519988-157520010 CAGGACAGACTTCTTGAAGTAGG + Intronic
1017787448 6:157768254-157768276 CTGGGGAGAGATAATTAAGTGGG + Intronic
1018341736 6:162858282-162858304 CAGGAGAGAGATAGAGAAGGCGG + Intronic
1021816494 7:24452220-24452242 CAGCACAGACAAAAAGAAGTGGG + Intergenic
1022109384 7:27219288-27219310 CAAGGGAGACATAATGAAGGAGG + Intergenic
1022166926 7:27775888-27775910 CAAGAAAGACATCATAAAGTGGG - Intronic
1023140806 7:37100602-37100624 CAGGAGGCACAGAATGAATTGGG - Intronic
1024702244 7:51916742-51916764 CAGGAGAGAGAGAGTGAAGGGGG + Intergenic
1026019161 7:66694683-66694705 CAGTAGGGAGAGAATGAAGTCGG + Intronic
1027150060 7:75727063-75727085 CAGGAGATACTTAATGAAAGGGG - Intronic
1027487976 7:78785967-78785989 AAGGAGAGAGATAGTGAAGCAGG + Intronic
1029103373 7:98153051-98153073 CAGGAGAGGCAGGAGGAAGTCGG + Intronic
1029914074 7:104188875-104188897 CAGGAGAGAGAGCATGAAGGGGG - Intronic
1031155553 7:118106684-118106706 CTGCAGACACATAATGGAGTGGG - Intergenic
1031316020 7:120258041-120258063 CAGGAGAGAGAGAGTGAAGGGGG - Intergenic
1031653789 7:124325988-124326010 CAGGAAAGCCATAATGGAGGAGG + Intergenic
1031785129 7:126020867-126020889 AAAGAGAGAAATAATTAAGTTGG + Intergenic
1032248263 7:130231414-130231436 CAGGAGAAAGAGAGTGAAGTGGG + Intergenic
1033537951 7:142329091-142329113 CAGGAGAGACAACATGAGGGTGG - Intergenic
1033820195 7:145125790-145125812 CAGGAGAGAGAGCACGAAGTGGG + Intergenic
1033890757 7:146010385-146010407 CAAGAGAGGCATAATGAAAATGG - Intergenic
1034737542 7:153443019-153443041 CAGGAGAGACATATCCAAGGTGG + Intergenic
1035311387 7:157971396-157971418 CAGGACAGAGAAATTGAAGTTGG + Intronic
1037125360 8:15341602-15341624 CAGGAGAGAGAGAGTGAAGGGGG - Intergenic
1037595029 8:20347841-20347863 CAGGAGAGACAGCAAGAAGGGGG + Intergenic
1037879844 8:22567181-22567203 CAGGAGAGACAAGAGCAAGTGGG + Intronic
1037933072 8:22895317-22895339 CTGGAGAGGCATAATAATGTTGG + Intronic
1038964041 8:32551430-32551452 CAGGGGAGAGATAATGGGGTGGG + Intronic
1039274226 8:35917697-35917719 TAGAAGAGACTTAATGAAGAGGG - Intergenic
1039700872 8:39960518-39960540 AAGGAGAGCCATAAGGCAGTAGG - Intronic
1040604562 8:48918846-48918868 CAGGAGAGACATTCTGGAGAAGG + Exonic
1040801699 8:51349372-51349394 CAAGTGAGACCAAATGAAGTTGG - Intronic
1041671948 8:60500411-60500433 CAGGATAGACAAAGTGAAGGGGG - Intergenic
1041968916 8:63714074-63714096 GAGGAGAGACATGAAGCAGTGGG + Intergenic
1042775380 8:72424914-72424936 CAGGAGAGAGAGAGTGAAGGGGG + Intergenic
1042940312 8:74100643-74100665 CAGGAGAAAGATAAGGAAGTGGG - Intergenic
1044064348 8:87681478-87681500 AGGGAGAGACATGAAGAAGTAGG - Intergenic
1044276966 8:90312478-90312500 CAGGAGAGAGAGAGTGAAGGGGG - Intergenic
1044648309 8:94468139-94468161 AAGGTGAGACATCTTGAAGTGGG - Intronic
1045475877 8:102551760-102551782 CAGAAGGGACATAAAGAAGGTGG + Exonic
1046065096 8:109186877-109186899 CAGGAGAGGCAGAATGGAGAGGG - Intergenic
1046268013 8:111857600-111857622 CAGGAGAGAGAGAGTGAAGTGGG - Intergenic
1047843873 8:128785009-128785031 CAGGAGGAAGAGAATGAAGTGGG + Intergenic
1048598043 8:135887541-135887563 CAGGAGAGAGAGAGTGAAGGGGG - Intergenic
1049103224 8:140594227-140594249 CAGGAGAGAAATAACTCAGTCGG + Intronic
1049899828 9:148799-148821 CAGGAGAGTGAAAATGAAGAGGG + Intronic
1049918778 9:344275-344297 AAAGAGAGAGATAATGAACTTGG + Intronic
1050199461 9:3128248-3128270 CAGGAAAGGAATAATGGAGTAGG - Intergenic
1050752091 9:8951290-8951312 CAGCAGAGAAATAATTAAGAAGG - Intronic
1051001525 9:12288408-12288430 CAGGAGAGAAAGAGTGAAGGGGG - Intergenic
1052003196 9:23313361-23313383 CAGAAGAGTTATAATGCAGTTGG - Intergenic
1052025943 9:23573136-23573158 CAGGAGAAAGAGAATGAAGGGGG + Intergenic
1052662848 9:31458093-31458115 CAGGAGAGAAAGAGTGAAGGGGG - Intergenic
1053616264 9:39769700-39769722 CAGGAGAGAAAGAGTGAAGGGGG + Intergenic
1053874429 9:42529007-42529029 CAGGAGAGAAAGAGTGAAGGGGG + Intergenic
1053898183 9:42765580-42765602 CAGGAGAGAAAGAGTGAAGGGGG - Intergenic
1054237253 9:62572689-62572711 CAGGAGAGAAAGAGTGAAGGGGG - Intergenic
1054267906 9:62937748-62937770 CAGGAGAGAAAGAGTGAAGGGGG - Intergenic
1054551388 9:66607200-66607222 CAGGAGAGAAAGAGTGAAGGGGG - Intergenic
1055770314 9:79709852-79709874 AAGAAGAGAAGTAATGAAGTGGG + Intronic
1057490948 9:95518964-95518986 CAGGAGTGGCATAATGAGGCAGG + Intergenic
1057962866 9:99473699-99473721 CAGGACAGACATTCTGAAGATGG - Intergenic
1058141990 9:101366440-101366462 CAGAAGAGACAATGTGAAGTAGG + Intronic
1058176224 9:101738541-101738563 GAGAAGAGAGAAAATGAAGTCGG - Exonic
1058589743 9:106550621-106550643 CAAAAGAAACATAAAGAAGTGGG + Intergenic
1058994093 9:110282729-110282751 CATGAAAGAAATAAAGAAGTAGG - Intergenic
1059444026 9:114327229-114327251 CAGGAGAGACAGAGCGAAGGGGG - Intergenic
1059445233 9:114334008-114334030 CAGGAGAGACAGAGCGAAGGGGG - Intergenic
1060327833 9:122634524-122634546 CAGGAGAGAGAAAATGCAGGGGG + Intergenic
1060717863 9:125950997-125951019 CAGGTAAGACATAATGAAACGGG + Intronic
1061201168 9:129139327-129139349 CAGGAGAGGCACACTGAACTTGG + Intronic
1061891653 9:133624633-133624655 CAGGAGAGAGAGAGTGAAGGAGG + Intergenic
1185465583 X:352582-352604 CAGCAGAGCCATAATGGAATAGG - Intronic
1187682668 X:21783389-21783411 CAGGAGAAAAATAATGAAATAGG - Intergenic
1191675507 X:63788193-63788215 TAGAGGAGACATAATGTAGTTGG + Intergenic
1191711127 X:64150991-64151013 CAGGAGAGAGAGAGAGAAGTGGG + Intergenic
1191830914 X:65415293-65415315 CAGGAGAGAATTAACAAAGTTGG - Intronic
1192176000 X:68885924-68885946 CAGGAGAGACACAAGAGAGTAGG - Intergenic
1192730999 X:73802598-73802620 CAAGAGAGACTTAAGGAAGGTGG + Intergenic
1193551256 X:82895695-82895717 CTGGAGAGACATGATCAAGATGG + Intergenic
1193998013 X:88390654-88390676 CAGGAGAGAGAGAGTGAAGGGGG + Intergenic
1194103166 X:89733491-89733513 CTGAAGTAACATAATGAAGTAGG + Intergenic
1194894318 X:99420746-99420768 AAGGAGAGACAGAAAGAATTGGG - Intergenic
1195433952 X:104821101-104821123 CAGAAGAGATATAATGCAATTGG - Intronic
1195593601 X:106661544-106661566 AAGGAGAGAAGTAATGAAGAAGG + Intronic
1195950326 X:110264912-110264934 CAGTTGATACATAATGAAGCAGG + Intronic
1198423857 X:136496277-136496299 CAGGGGAGACAGAATTAAGATGG - Intergenic
1199035013 X:143039878-143039900 CAGGAGAGAGATAGTGAAGGGGG + Intergenic
1199273953 X:145920963-145920985 CAGGAGAGACAGAGCGAAGGGGG - Intergenic
1199404658 X:147443096-147443118 CAGGAGTGACATCCTTAAGTAGG + Intergenic
1199525219 X:148784415-148784437 AAGGAGAGACAAGAGGAAGTTGG + Intronic