ID: 1147120194

View in Genome Browser
Species Human (GRCh38)
Location 17:38331111-38331133
Sequence CGCTGGCTGACCTGAAGCCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 195}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147120191_1147120194 -5 Left 1147120191 17:38331093-38331115 CCACCGTCAGGTTGTGGGCGCTG 0: 1
1: 0
2: 0
3: 6
4: 62
Right 1147120194 17:38331111-38331133 CGCTGGCTGACCTGAAGCCCAGG 0: 1
1: 0
2: 1
3: 14
4: 195
1147120185_1147120194 18 Left 1147120185 17:38331070-38331092 CCGGGCTCTGGGTAGCCTCTCTC 0: 1
1: 0
2: 3
3: 29
4: 308
Right 1147120194 17:38331111-38331133 CGCTGGCTGACCTGAAGCCCAGG 0: 1
1: 0
2: 1
3: 14
4: 195
1147120187_1147120194 3 Left 1147120187 17:38331085-38331107 CCTCTCTCCCACCGTCAGGTTGT 0: 1
1: 0
2: 0
3: 15
4: 196
Right 1147120194 17:38331111-38331133 CGCTGGCTGACCTGAAGCCCAGG 0: 1
1: 0
2: 1
3: 14
4: 195
1147120190_1147120194 -4 Left 1147120190 17:38331092-38331114 CCCACCGTCAGGTTGTGGGCGCT 0: 1
1: 0
2: 1
3: 3
4: 23
Right 1147120194 17:38331111-38331133 CGCTGGCTGACCTGAAGCCCAGG 0: 1
1: 0
2: 1
3: 14
4: 195
1147120193_1147120194 -8 Left 1147120193 17:38331096-38331118 CCGTCAGGTTGTGGGCGCTGGCT 0: 1
1: 0
2: 2
3: 10
4: 166
Right 1147120194 17:38331111-38331133 CGCTGGCTGACCTGAAGCCCAGG 0: 1
1: 0
2: 1
3: 14
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147120194 Original CRISPR CGCTGGCTGACCTGAAGCCC AGG Exonic
900102411 1:967476-967498 TCCTGTCTGCCCTGAAGCCCAGG - Intronic
900180577 1:1309262-1309284 CGCGGGCTCACCTGATGGCCGGG - Exonic
900418240 1:2544794-2544816 GGCAGGCTGTCCTGGAGCCCCGG - Intergenic
900801346 1:4738892-4738914 CGCTGGAAGACCTGGGGCCCTGG + Intronic
901061399 1:6473525-6473547 CCCAGGCTGGCCTGAGGCCCTGG - Intronic
902227417 1:15005416-15005438 TTCTGGCTAACCTGGAGCCCAGG - Intronic
902678846 1:18029087-18029109 TCATGGTTGACCTGAAGCCCAGG + Intergenic
903225440 1:21892174-21892196 CGCTGCCTGCCCTGAACCGCTGG + Intronic
903501498 1:23802438-23802460 CCCTTGCCCACCTGAAGCCCTGG - Exonic
903778827 1:25809163-25809185 CACTGGCTGGCCTGGAGCACCGG + Intronic
904372230 1:30057105-30057127 CACAGGCTGAGCTGAAGGCCAGG - Intergenic
907756171 1:57312960-57312982 CGCTTGCTCTCATGAAGCCCTGG + Intronic
912775063 1:112501777-112501799 CTCTGGCTGACCCGAATCCCCGG + Intronic
913282418 1:117198996-117199018 TGCTGGCTGAGCAGATGCCCAGG - Intronic
914753105 1:150549202-150549224 GGCTGCGTGAGCTGAAGCCCGGG - Intergenic
915278702 1:154807760-154807782 CTCGGGCTGCCCTCAAGCCCTGG + Intronic
915835366 1:159171714-159171736 CGCTGGCGAGCCTGAATCCCCGG - Exonic
916437600 1:164791365-164791387 CACTGGCTTCCCTGAAACCCTGG + Intronic
917163929 1:172090391-172090413 CTCTGGCTGCCCTCATGCCCTGG - Intronic
917477714 1:175383347-175383369 CTCTGGTTGACCAGATGCCCTGG + Intronic
917533139 1:175854982-175855004 CCCTGGCTGATCTCAAACCCTGG + Intergenic
918096639 1:181341556-181341578 GGCTGGTTGAGCTGAAGCCCAGG - Intergenic
918262197 1:182806331-182806353 CACCAGCTGACCTCAAGCCCCGG - Intronic
919117964 1:193305036-193305058 CGCTGGCTCACACGCAGCCCCGG + Intergenic
922346538 1:224701100-224701122 TGCTGGCTGCCCGGAAGCCATGG + Intronic
923032798 1:230263294-230263316 GGCTGGGTGACCTGAAGGACTGG + Intronic
923474118 1:234316831-234316853 AGCTGCCTGTCCTGAAGCACAGG - Intronic
923506839 1:234611315-234611337 CGGTGGCAGACCTGCAGGCCGGG - Intergenic
924949320 1:248867739-248867761 CGAGGGCTGGCCTGAAGCCTAGG - Intergenic
1063123885 10:3123735-3123757 CACTGGCTGGCCTGGTGCCCAGG - Intronic
1064246837 10:13674980-13675002 TGCTGGCTGCCTTGAAGTCCAGG - Exonic
1066761217 10:38755264-38755286 CGCTGGCTGAGGTGAAGTCCGGG - Intergenic
1067275490 10:44829478-44829500 CACTGGCTGCGCTGAAGCGCTGG - Intergenic
1069135002 10:64752878-64752900 CTCTGTCTGTCCTGAAGCACAGG - Intergenic
1070779251 10:79127923-79127945 CGCTGGCTGAGCAGTGGCCCTGG - Intronic
1075450858 10:122551235-122551257 CCCTGGGGGCCCTGAAGCCCTGG - Intergenic
1075840006 10:125493642-125493664 CGCTGGCATACATGCAGCCCGGG - Intergenic
1076673176 10:132134155-132134177 CGCTGGGGGATCTGAAGTCCAGG + Intronic
1077190468 11:1254017-1254039 CGCTGGCTGCCATGACGCCTGGG + Intronic
1078317651 11:10306014-10306036 GGCTCGCTGACGTGAAGGCCGGG + Exonic
1083651248 11:64206120-64206142 AGCTGGGTGACCTGAGGGCCCGG + Intergenic
1083911225 11:65711403-65711425 CGCTGGCTGCACTCCAGCCCGGG + Intergenic
1084901621 11:72314313-72314335 TGCAGGCTGACCTGCTGCCCAGG + Intronic
1090263832 11:125341873-125341895 GGCTGGCTTTCCTGAAGCTCAGG + Intronic
1091304699 11:134530021-134530043 CGTTGGCTGATCTGAGGCTCTGG + Intergenic
1091594234 12:1865008-1865030 CGCTGGCTGAGGTCATGCCCAGG + Intronic
1092241668 12:6839682-6839704 CGCTGCCGGACCTGCAGCCCTGG + Exonic
1096526256 12:52212011-52212033 TGCTGGCAGAGCTGAAGCCGCGG - Intergenic
1102405763 12:112672886-112672908 TTCTGGCTGACCTGATGCACAGG - Intronic
1103084553 12:118052444-118052466 TGCTGGCCGAACTCAAGCCCGGG - Exonic
1107012430 13:35681763-35681785 GGCTGGCTGCCCAGAGGCCCAGG + Intergenic
1108244779 13:48503441-48503463 GGCTGTATGACCTGGAGCCCAGG + Intronic
1108465565 13:50711844-50711866 AGCTGGCTGCCCTGAGTCCCAGG - Intronic
1109426103 13:62167917-62167939 CGCTGCCTAACCTGCAGACCTGG + Intergenic
1109715982 13:66222930-66222952 TGCTGCCTGAACTGCAGCCCTGG + Intergenic
1112936324 13:104804235-104804257 AGCTGCCTGACCTCAACCCCAGG + Intergenic
1115405074 14:33005991-33006013 AGCTGGCTGACCAGAAGGCGGGG + Intronic
1118993020 14:70812667-70812689 GGATGGCTGACTTGAATCCCAGG + Intergenic
1119160680 14:72449894-72449916 CTCTGGCTATCCTCAAGCCCTGG - Intronic
1119644803 14:76340447-76340469 AGCTGGCTGACATGAAGCCACGG - Intronic
1122982863 14:105199430-105199452 CGGTGGCAGTCCTGCAGCCCAGG - Intergenic
1123039237 14:105483652-105483674 GCCTGGCTGGCCTGCAGCCCCGG + Intergenic
1123420599 15:20127363-20127385 CGCTGGCCGAGGTGAAGTCCGGG + Intergenic
1123445262 15:20326164-20326186 CGCTGGCTGAGGTGAAGTCCAGG - Intergenic
1123529823 15:21133892-21133914 CGCTGGCCGAGGTGAAGTCCGGG + Intergenic
1124156154 15:27226600-27226622 CGGTGGCTCCTCTGAAGCCCGGG - Intronic
1129333640 15:74840050-74840072 TGTGGGCTGACCTGAGGCCCTGG + Intronic
1129452218 15:75657460-75657482 CACTGACTGACCGGCAGCCCAGG - Exonic
1130150252 15:81306340-81306362 CCCGGGCTCACTTGAAGCCCAGG + Intronic
1132674137 16:1114690-1114712 GGGTGGCTGGCCTGAGGCCCCGG - Intergenic
1132759281 16:1501004-1501026 ACCTGGCTGCCCTGCAGCCCCGG - Intronic
1133038175 16:3046252-3046274 GGCTGGCTGAGCCGAAGGCCCGG + Intergenic
1133927708 16:10206539-10206561 CGCTGGGCAAGCTGAAGCCCTGG + Intergenic
1134004587 16:10809746-10809768 GTCTGTCTGACCTAAAGCCCAGG + Intronic
1135509756 16:23072132-23072154 CGCTGGCTGGCTTGCTGCCCGGG + Exonic
1136514807 16:30761792-30761814 CGCTGGCTGTCCTGGAACCTAGG - Exonic
1141543424 16:84745188-84745210 CTCTGGCTGCCCTGCAGTCCTGG - Exonic
1141677871 16:85527131-85527153 AGCGGCCTGACTTGAAGCCCAGG + Intergenic
1142222306 16:88861532-88861554 CGTTGGCTCAGCTGCAGCCCTGG + Exonic
1142353166 16:89588944-89588966 CGAGGCCTGACCTGGAGCCCAGG - Intronic
1142481831 17:223822-223844 AGCTGGCTGCCGTGAAGACCTGG + Intronic
1143884443 17:10055412-10055434 CCCTGGCGGACCTCAGGCCCTGG + Intronic
1146926099 17:36746630-36746652 GGCTGGCTGAGCTGAAGCTGGGG + Intergenic
1147120194 17:38331111-38331133 CGCTGGCTGACCTGAAGCCCAGG + Exonic
1148765936 17:50038201-50038223 TGCTGGCTGGCCTGGAGGCCGGG - Intergenic
1149224546 17:54454048-54454070 AGCTGGCTGCACTGCAGCCCTGG - Intergenic
1150008884 17:61486992-61487014 TGCTGGCTGAGCTGGAGACCCGG - Intergenic
1152260274 17:79263061-79263083 CCCTGCCTGAGCTGAAGGCCTGG - Intronic
1152835083 17:82524708-82524730 CTCTGACTGACCTGAGGCGCAGG + Intronic
1153626220 18:7024594-7024616 GGCTGGGTGACCAGAGGCCCCGG - Intronic
1157272862 18:46290039-46290061 AGCTGCCTGACCTGCAGACCAGG + Intergenic
1157560400 18:48641449-48641471 GGCAGGTTCACCTGAAGCCCTGG + Intronic
1157609514 18:48947756-48947778 CACTGGCTGGCATGAAGCCATGG - Intronic
1159927739 18:74283796-74283818 CGCAGCCTGGACTGAAGCCCTGG + Intronic
1160734626 19:656917-656939 CGCCAGCTGACCGGGAGCCCAGG + Intronic
1161064658 19:2231657-2231679 GGCTGCCTGTCCTGAAGGCCAGG - Exonic
1162550260 19:11354803-11354825 CGGTCCCTGACCTGCAGCCCCGG + Intronic
1163277909 19:16297003-16297025 CGCTGGCTGCCCAGCTGCCCGGG - Intergenic
1163602474 19:18257399-18257421 AGCTGGCTGCCCTGAGTCCCAGG - Exonic
1166566110 19:43766688-43766710 CGCTGGCCGAGCTGAAGAACTGG - Exonic
1167258194 19:48443300-48443322 CGCTGGGCGGCCTGGAGCCCTGG + Exonic
1167515655 19:49921790-49921812 TGCTGGCTGGGCTCAAGCCCGGG + Intronic
925927726 2:8682111-8682133 AGCTGGCTGCCCTGAAGCTCAGG - Exonic
927441559 2:23122085-23122107 CACTGACTGACCTAAAGCCAAGG + Intergenic
927511227 2:23644878-23644900 CGCTGGCTCACCAGAAGGCAGGG - Intronic
927666421 2:25036046-25036068 GGCTGGGTGACTTGAACCCCTGG - Intergenic
929732334 2:44509189-44509211 TCCTGGCTGAGCTGAAACCCTGG - Intronic
930033425 2:47071654-47071676 GGCTTGCTGGCCGGAAGCCCTGG - Intronic
930099952 2:47595843-47595865 CCCTGGCTGGACTGAACCCCTGG + Intergenic
932338060 2:70942322-70942344 CTCTGGCTGTCCTCAAGGCCCGG + Exonic
933956277 2:87375337-87375359 CGCTGGCCGAGGTGAAGTCCAGG - Intergenic
934240427 2:90267361-90267383 CGCTGGCCGAGGTGAAGTCCAGG - Intergenic
934272763 2:91549386-91549408 CGCTGGCCGAGGTGAAGTCCAGG + Intergenic
937070825 2:119061799-119061821 CGCTGGGGGAACTGAAACCCCGG + Intergenic
937200913 2:120204087-120204109 TCCTGGCTGCCCTCAAGCCCTGG - Intergenic
937233913 2:120419009-120419031 CGGTGGGGAACCTGAAGCCCTGG + Intergenic
937248900 2:120511200-120511222 TCCTGGCTGCCCTGGAGCCCCGG - Intergenic
937266271 2:120616493-120616515 TGCAGGCTGAGCTCAAGCCCTGG - Intergenic
937268840 2:120634153-120634175 CCCAGGCTGACCGGAAGTCCTGG + Intergenic
937439546 2:121904454-121904476 CCCTGGCTGCCCTCAAGCCCGGG - Intergenic
944207051 2:197168048-197168070 GCCTTGCTGAACTGAAGCCCTGG + Intronic
946013011 2:216581680-216581702 TGTTAGCTGACCTGGAGCCCTGG + Intergenic
948488075 2:238293951-238293973 TACTGGCTGCCCAGAAGCCCTGG - Intergenic
1172104005 20:32505003-32505025 CTCAGGCTGCCCTGCAGCCCAGG - Intronic
1173382996 20:42562789-42562811 GGATGGCTGGCCTGTAGCCCTGG - Intronic
1173738646 20:45380113-45380135 CGCTGGCTGCCCTGAATCCCTGG + Intronic
1175807801 20:61840220-61840242 CTCTGGCTGACAGGAGGCCCTGG + Intronic
1176428800 21:6563979-6564001 GGCTGGCTCCCCTGCAGCCCTGG + Intergenic
1177255918 21:18662803-18662825 GGCTGCCTCACCAGAAGCCCAGG - Intergenic
1178878444 21:36430152-36430174 CCCTGACTAATCTGAAGCCCTGG - Intergenic
1179281361 21:39936959-39936981 GGCTGGCTGACCACAAGCCCAGG - Intergenic
1179704290 21:43172295-43172317 GGCTGGCTCCCCTGCAGCCCTGG + Exonic
1180228290 21:46411487-46411509 TGCTGGCTGACCAGGAGCGCAGG + Exonic
1181287700 22:21766249-21766271 AGCTGCCTGACCTGAAGCAGTGG - Intronic
1181898082 22:26128898-26128920 TGCAGGCAGACCTGATGCCCAGG - Intergenic
1182468109 22:30530769-30530791 GGCTGGCTGCCCTGCGGCCCAGG + Intronic
1184554694 22:45226843-45226865 GGCTGGGTGGCCTCAAGCCCAGG - Intronic
950084985 3:10250988-10251010 CCCTGGCTGTCCTAAAGACCTGG + Intronic
953033164 3:39190977-39190999 ACCTGGCTGGCCTGCAGCCCAGG - Intronic
953172962 3:40524619-40524641 CCGTGGCTCACCTGAAGCCTGGG - Intergenic
953570454 3:44067439-44067461 CCCTAGCTGCCCTGCAGCCCTGG - Intergenic
954646622 3:52135619-52135641 CGCTGGCAGACCTGGGTCCCAGG + Intronic
955744269 3:62124641-62124663 AGCTGGCTGTCCTGAAGCTCAGG + Intronic
956290524 3:67655091-67655113 CCTTGACTCACCTGAAGCCCTGG - Intergenic
960963529 3:123089308-123089330 CGATGGTTGACCTCAAGGCCAGG - Intronic
961391778 3:126556374-126556396 GGCTGGCTGAGCTGCAGCCATGG + Intronic
965559335 3:170046476-170046498 CACTGGCTGCCCAGAAGACCTGG - Intronic
967553084 3:190822884-190822906 GGCTGGCTGGCCTGGAGCCTGGG + Intergenic
969591354 4:8123553-8123575 GGATGGCTGGCCTGGAGCCCAGG + Intronic
973989254 4:56387555-56387577 CGCTGCCTCTCCTGAAGCCGAGG + Intergenic
976436991 4:85029666-85029688 GGCTGGCTGGCCAGAGGCCCAGG + Intergenic
978339478 4:107707173-107707195 CTGGGGCAGACCTGAAGCCCAGG + Intronic
979536196 4:121823461-121823483 CGCTGGCGGTACTGAAGTCCGGG - Exonic
980811172 4:137882532-137882554 GTCTGGCTTACCTGAATCCCAGG - Intergenic
985938386 5:3114137-3114159 CGGTGGATCACCTGAGGCCCAGG + Intergenic
986876855 5:12121982-12122004 GGTTGGCTGACCTCAAGTCCAGG + Intergenic
987358428 5:17084933-17084955 AGCTGGAGGACCTGGAGCCCAGG - Intronic
990003883 5:50923284-50923306 GGAAGGCTGACCAGAAGCCCCGG - Intergenic
990328765 5:54704648-54704670 GGGTGTCTGACCAGAAGCCCAGG + Intergenic
991039676 5:62162597-62162619 CCAGGGCTGACCTGAAGCCTCGG - Intergenic
995687298 5:114784716-114784738 CGCTGGCTGACCTTTAGCACTGG - Intergenic
996473006 5:123881886-123881908 CGCTGTCTGATATGAAGACCAGG + Intergenic
997280623 5:132642010-132642032 GCCTGGCTGGCCTGAAGGCCTGG + Intronic
997641651 5:135452472-135452494 GGCTGGCAGAACTGAAACCCAGG - Intergenic
1001083960 5:168686968-168686990 TCCTGCCTTACCTGAAGCCCTGG + Exonic
1001486518 5:172123422-172123444 TGCTGGCTGAGCTGTAGCCTAGG + Intronic
1003007380 6:2394234-2394256 GGCTGGATCACCTGGAGCCCAGG + Intergenic
1003135594 6:3432703-3432725 GGCTGGCAAACTTGAAGCCCTGG + Intronic
1005959786 6:30686776-30686798 CGCTGGCAGCCCTGACGCCCGGG - Exonic
1006367329 6:33623092-33623114 CCCTGGCTGCCCTGAGGCCAGGG + Intronic
1006855325 6:37129085-37129107 CTCTGGCAGCCCTGAAGCTCTGG - Intergenic
1007703946 6:43780081-43780103 GGCTGGGTGTCCTGGAGCCCTGG - Intronic
1016608688 6:145964044-145964066 CGCTGGTTGTCCTGGAGCCCGGG - Intronic
1017221931 6:151975542-151975564 GGCTGGCTGACTGGAAGCTCAGG + Intronic
1017774877 6:157672920-157672942 CGCTCGCGGACGTGATGCCCCGG + Exonic
1018746388 6:166765277-166765299 CACCTGCTGACCTGCAGCCCTGG - Intronic
1019540582 7:1549485-1549507 CACTGCCTGGCCAGAAGCCCTGG + Intronic
1020137239 7:5594158-5594180 CGCCGGCTGTCCTGGAGCTCGGG + Intronic
1020254955 7:6497819-6497841 CGCTGAGTGACCTGCAGGCCGGG - Exonic
1021838863 7:24706314-24706336 TGCTGGGGGAGCTGAAGCCCCGG - Exonic
1029203810 7:98856345-98856367 GGCCAGCTGACCTGGAGCCCTGG - Intronic
1029707471 7:102283364-102283386 CGCAGCCTGACCTCTAGCCCTGG + Intronic
1031523712 7:122798277-122798299 GGCTGGGTGAACTGCAGCCCTGG - Intronic
1032201820 7:129827550-129827572 CCCTGGCTGACCTCCTGCCCAGG - Intergenic
1032947654 7:136870798-136870820 GGCTGGCAGACTTGGAGCCCTGG - Intronic
1038218441 8:25584744-25584766 CCTGGGCTGGCCTGAAGCCCAGG - Intergenic
1049230617 8:141479451-141479473 TGCTGGCTGCCCTGGGGCCCTGG - Intergenic
1049415405 8:142492694-142492716 AGCTGGGTGCCCTGCAGCCCTGG + Intronic
1049454015 8:142677922-142677944 CAGGGGCTGACCTGGAGCCCCGG + Intronic
1053221701 9:36318067-36318089 AGCTGGCTGCCCTGGAGCTCCGG + Intergenic
1053282384 9:36829121-36829143 CCCTGGCTGATCTGAAACTCTGG + Intergenic
1053308853 9:37002678-37002700 CGCTGGGGGACGTGATGCCCAGG + Exonic
1054810392 9:69429485-69429507 CGCTGGCTGCCCAGGTGCCCTGG - Exonic
1056590749 9:87964114-87964136 CGCAAGCTGCCCAGAAGCCCCGG - Intergenic
1057266269 9:93620013-93620035 ATTTGGCTGAGCTGAAGCCCAGG - Intronic
1057879412 9:98781904-98781926 AGCTGGCTAACTGGAAGCCCAGG + Intronic
1059020974 9:110575992-110576014 CACTGGCTGGTCTGAACCCCAGG + Intronic
1060481433 9:124018603-124018625 CGGTGGCCGAGCTGAATCCCGGG - Intronic
1060601358 9:124880355-124880377 TGCAGGCTGACCTGAACCTCAGG - Exonic
1060984175 9:127810132-127810154 GGCAGGCAGTCCTGAAGCCCTGG + Intronic
1061487935 9:130929681-130929703 CGCTGGCCGACCAGCTGCCCCGG - Exonic
1062070595 9:134553199-134553221 CCCAGGCTGAGCTGGAGCCCCGG - Intergenic
1062242603 9:135548299-135548321 CACTGGCTGCCCTGCCGCCCTGG - Intronic
1185735492 X:2492694-2492716 ATGTGGCTGGCCTGAAGCCCAGG + Intronic
1189195435 X:39148406-39148428 CGCTGGCTTGTCTGAAGTCCTGG - Intergenic
1192590266 X:72353795-72353817 CTCTTGGAGACCTGAAGCCCTGG + Intronic
1192615773 X:72620671-72620693 CACAGGATGACGTGAAGCCCAGG - Intronic
1198327443 X:135587379-135587401 CTCTTGCTGACCTGGAGCCCTGG + Intergenic
1199766720 X:150946796-150946818 TGCTGGCCCACCTGGAGCCCAGG + Intergenic
1200074991 X:153546460-153546482 GGCTGACTCACCTGAAGCTCTGG + Intronic
1200175827 X:154115626-154115648 GGCTGGCTGCCCTCAAGCCTGGG + Intergenic