ID: 1147121568

View in Genome Browser
Species Human (GRCh38)
Location 17:38338160-38338182
Sequence AAGGAAGCTGCTCCTCCGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 1, 2: 2, 3: 12, 4: 181}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147121568_1147121573 -6 Left 1147121568 17:38338160-38338182 CCCCACGGAGGAGCAGCTTCCTT 0: 1
1: 1
2: 2
3: 12
4: 181
Right 1147121573 17:38338177-38338199 TTCCTTCACCAGGGACCATCTGG 0: 1
1: 0
2: 1
3: 20
4: 183
1147121568_1147121576 6 Left 1147121568 17:38338160-38338182 CCCCACGGAGGAGCAGCTTCCTT 0: 1
1: 1
2: 2
3: 12
4: 181
Right 1147121576 17:38338189-38338211 GGACCATCTGGCTTTCGCACAGG 0: 1
1: 0
2: 0
3: 3
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147121568 Original CRISPR AAGGAAGCTGCTCCTCCGTG GGG (reversed) Intronic
900383662 1:2398998-2399020 GATGAAGCTGCTCCTGGGTGGGG + Intronic
907356287 1:53877371-53877393 GAGGAAGCTGATGCTCAGTGAGG - Intronic
909923034 1:81405172-81405194 AAGCATGCTGCTCCTCAGAGTGG - Intronic
910631005 1:89354303-89354325 CAGGAAGTTGCTTCTCCCTGGGG - Intergenic
911464383 1:98233461-98233483 ATGGCAGCTGCTCCTCCTTATGG - Intergenic
912581396 1:110724205-110724227 AAGGATGCTGCCCCTCCCTGAGG + Intergenic
913240713 1:116826951-116826973 AAGAAAGCTGCTCCCAAGTGTGG - Intergenic
913931534 1:124971195-124971217 AAGGAAGCTTCAACTCTGTGAGG + Intergenic
915642444 1:157239244-157239266 CAGGAAGTTGCTTCTCCCTGGGG + Intergenic
915666928 1:157453626-157453648 CAGGAAGCTGCTGTTCCCTGGGG - Intergenic
915907461 1:159889291-159889313 AAGAAAGCTGCTTCTGGGTGAGG + Intronic
916933431 1:169603508-169603530 AAGGAAGCTGGTGCTCTGTTTGG + Intronic
924456598 1:244223558-244223580 AGGGAAGCTGCTCCCACCTGAGG - Intergenic
1063086578 10:2823589-2823611 CAGGAAGCTGCACCTCCCAGAGG + Intergenic
1064372646 10:14766456-14766478 AAGGAAACTGGAACTCCGTGAGG - Intronic
1066831847 10:39751966-39751988 AAGGAAGGTTCAACTCCGTGAGG - Intergenic
1066832181 10:39758084-39758106 AAGGAAGGTTCAACTCCGTGAGG - Intergenic
1070402298 10:76063907-76063929 GAGGAAGCTGCTCGCCCCTGGGG + Intronic
1070731185 10:78829501-78829523 AAGGAAAGTGCCCCTCGGTGGGG + Intergenic
1073136044 10:101221005-101221027 AAGGAAGTTCCTCCTCCCCGTGG - Intergenic
1073630527 10:105143861-105143883 AAGGAAGCCGGTTCTCCATGAGG - Intronic
1074020142 10:109574185-109574207 AAGGAAGCTGCTGCTCTGTTCGG + Intergenic
1074081477 10:110171101-110171123 AAGGCAGCTGCCCCTCGTTGGGG + Intergenic
1074233903 10:111565696-111565718 CAGGAAGCTGCTACTCCCTCTGG + Intergenic
1074853551 10:117457336-117457358 AGGGAAGCTGCTCACCTGTGTGG + Intergenic
1076078899 10:127560000-127560022 AAGCAAGCTTCTCCTTCGTAGGG + Intergenic
1076706495 10:132304871-132304893 CAGGAAGTAGCTCCTCCCTGAGG - Intronic
1076987599 11:250372-250394 AAGGAAGCTTTTCCTCAGAGGGG + Intronic
1077182290 11:1222234-1222256 GAGGAAGCAGCTGCTCCGGGGGG - Intergenic
1079130671 11:17745224-17745246 AAGCAAGCCGCTCCTTCCTGAGG + Intronic
1079598494 11:22283858-22283880 CAGGAAGTTGCTTCTCCCTGGGG - Intergenic
1079894572 11:26102636-26102658 CAGGAAGTTGCTTCTCCCTGGGG + Intergenic
1080962858 11:37180639-37180661 CAGGATGCTGCTTCTCCCTGGGG - Intergenic
1081641237 11:44755798-44755820 GAGGACGCTGCTCCTTCTTGGGG + Intronic
1082317959 11:50752922-50752944 AAGAAAGTTTCTCCTCTGTGAGG + Intergenic
1084489434 11:69470584-69470606 ATGGAAGCGGCTCCTGAGTGAGG + Intergenic
1086900936 11:92366798-92366820 AAGGTAGCTGATCTTCAGTGAGG + Intronic
1087095595 11:94314478-94314500 AAGGGAGCTGCACCTCTGAGGGG + Intergenic
1090472275 11:126990668-126990690 TAGGAAGCTGCACCTGAGTGAGG - Intronic
1097906196 12:64921944-64921966 CAAGAAGCTGCTTCTCCCTGGGG + Intergenic
1101709969 12:107256215-107256237 AAGGGATCTGCTACCCCGTGAGG - Intergenic
1102612896 12:114128258-114128280 AACGAAGCTCCTCCACCATGGGG - Intergenic
1103191304 12:119004445-119004467 AAGGAAGCTGCTCCTGAGAGGGG + Intronic
1105096368 13:16377235-16377257 AAGGAAGGTTCTCCTCTGTTAGG - Intergenic
1105097611 13:16397698-16397720 AAGGAAGGTTCTCCTCTGTTAGG - Intergenic
1105100213 13:16440004-16440026 AAGGAAGGTTCTCCTCTGTTAGG - Intergenic
1105115363 13:16687625-16687647 AAGGAAGGTTCTTCTCCGTTAGG - Intergenic
1105121367 13:16785710-16785732 AAGGAAGCTTCTTCTCTGTTAGG - Intergenic
1105128381 13:16900130-16900152 AAGGAAGGTTCTCCTCTGTTAGG - Intergenic
1105128867 13:16908315-16908337 AAGGAAGGTTCTCCTCTGTTAGG - Intergenic
1105135950 13:17023957-17023979 AAGGAAGGTTCTCCTCTGTTAGG - Intergenic
1105141964 13:17122009-17122031 AAGGAAGGTTCTTCTCCGTTAGG - Intergenic
1105150485 13:17261029-17261051 AAGGAAGCTTCTTCTCTGTTAGG - Intergenic
1106584577 13:31045971-31045993 ACGGAAGCTGCTGCTCCGTGTGG + Intergenic
1108510236 13:51148909-51148931 CAGGCAGCTGCTCCTTCCTGGGG + Intergenic
1108930147 13:55807534-55807556 TAGGACCCTGCTGCTCCGTGCGG - Intergenic
1111916370 13:94364853-94364875 AAGGAAGATGCCCCTCCCTATGG + Intronic
1113338917 13:109403115-109403137 AAGGCTGCTGCTTCTCTGTGTGG + Intergenic
1114458642 14:22872917-22872939 AAGGAAGCTGAGGCTCGGTGTGG + Intronic
1118693071 14:68359024-68359046 GTGGCAGCTGCTCCTCTGTGGGG - Intronic
1119657109 14:76425139-76425161 AAGGCAGCTCCTGCTCCCTGTGG - Intronic
1123450546 15:20357039-20357061 ATGGAAGCTGCTCTTCCTGGGGG + Intergenic
1124158510 15:27249219-27249241 GGGGAGGCTGCTCCTCCGCGTGG + Intronic
1127935115 15:63629673-63629695 AAGGAAGCTGCTCGTCATTGTGG - Intronic
1130535001 15:84778224-84778246 AAGGAAGACGCTCCCCCGTACGG + Exonic
1134231763 16:12435411-12435433 AAGGGAGCAGCTCCTCCTTAGGG + Intronic
1136392289 16:29973477-29973499 AAGGAAGCTGCTGCTGGGCGCGG - Intergenic
1137877895 16:52014730-52014752 AAGGCAGCTGCTCTTTGGTGGGG - Intronic
1139245006 16:65433148-65433170 AAGGATGCTGCTCCTTCCAGGGG - Intergenic
1140194427 16:72845059-72845081 CAGGTTCCTGCTCCTCCGTGTGG + Intronic
1140556804 16:75930671-75930693 ATGGAAGCTGCTCCTCCAGAGGG + Intergenic
1145010711 17:19366177-19366199 AAGGAAGCTGGGCCTCCTTGAGG + Intronic
1146568915 17:33936552-33936574 AGGGAAACTACTCCTCTGTGAGG + Intronic
1147121568 17:38338160-38338182 AAGGAAGCTGCTCCTCCGTGGGG - Intronic
1148816789 17:50333678-50333700 GAGGAAGCTGCCTCTCTGTGGGG + Intergenic
1150813402 17:68374395-68374417 AAGTAAGTGGCTTCTCCGTGGGG + Intronic
1152337891 17:79708295-79708317 ATGGAAGCTGCTCTTCCTGGGGG - Intergenic
1153148279 18:2058209-2058231 CAGGAAGTTGCTTCTCCCTGGGG + Intergenic
1155614444 18:27704825-27704847 AAGTAAGCTGTTTTTCCGTGGGG + Intergenic
1159144990 18:64442594-64442616 CAAGAAGCTGCTCCTCCCTGGGG + Intergenic
1159643360 18:70888807-70888829 TAGGAAGCTGTTATTCCGTGGGG + Intergenic
1160436673 18:78857203-78857225 GAGGAGGCAGCTCCTCAGTGTGG + Intergenic
1160683277 19:422316-422338 GACGCAGCTGTTCCTCCGTGGGG + Exonic
1161894656 19:7071296-7071318 AAGGTAGCTGCTGGTCCATGCGG + Intronic
1163636285 19:18438448-18438470 AGGGAAGCTGGGCCTCCGGGGGG + Intergenic
1164520029 19:28972161-28972183 ACGGTAGCTGGTGCTCCGTGTGG - Intergenic
1165112451 19:33510327-33510349 AAGGAAGAAGCTCCTCCATATGG + Intronic
1165411619 19:35665784-35665806 CAGGTGGCTGCTCCTCTGTGAGG - Intergenic
1166733510 19:45071434-45071456 CAGGAGGCTTCCCCTCCGTGGGG - Intergenic
925847168 2:8044444-8044466 CAGGGAGCTGCTCCTCCATGGGG - Intergenic
926386068 2:12336957-12336979 AAGTAGGCTGGTCCTCCATGTGG - Intergenic
927537164 2:23872556-23872578 AGGGTAGCTGATCCTCCGTGAGG + Intronic
928043399 2:27901665-27901687 AAGGAAGCTGCTGCCCTGGGAGG + Intronic
928210426 2:29319824-29319846 AAGGATGCTGCTGCACAGTGGGG + Intronic
929457231 2:42074644-42074666 AAGGAGGATGCTGCTCCCTGGGG - Intergenic
931401812 2:61938238-61938260 CAGGAAGCTGCTCCTCCGTGGGG - Intronic
932486903 2:72089638-72089660 CAGGAAGCCGCTTCTCCCTGGGG - Intergenic
934082774 2:88483571-88483593 GAGGAAGCTGGTCCTCGGAGAGG - Intergenic
934847495 2:97671602-97671624 AAGGCAGGTGCTCTTCCTTGAGG + Intergenic
940041461 2:149366036-149366058 AAGGAAGCTGTGCTTCAGTGTGG + Intronic
940117581 2:150225870-150225892 CAAGAAGCTGCTTCTCCCTGGGG + Intergenic
940360614 2:152792238-152792260 CAGGAAGTTGCTTCTCCCTGAGG - Intergenic
942699536 2:178689052-178689074 AAGAAAGCTCCTCCTCCCCGAGG - Exonic
945775628 2:214103154-214103176 CAAGAAGCTGCTTCTCCCTGGGG + Intronic
946126542 2:217567872-217567894 AAGAAAGCTGCTCCTCCTTTGGG - Intronic
948335624 2:237204847-237204869 GTGGAAGGTGCTGCTCCGTGAGG + Intergenic
1171734262 20:28754559-28754581 AAGAAAGCTTCACCTCTGTGAGG - Intergenic
1175191631 20:57215668-57215690 CAGGCAGCTGCCCATCCGTGTGG - Intronic
1175598032 20:60250980-60251002 AAGGAAACTGCACCTCAGGGAGG - Intergenic
1175909334 20:62397134-62397156 ACGGGGGCTGCTCCTCCGTCTGG + Intronic
1179146189 21:38769800-38769822 AAGTAACCTGCGCCTCTGTGAGG - Intergenic
1179487093 21:41717313-41717335 GAGGAAGGTGCTCCCCAGTGAGG - Intergenic
1179568531 21:42264158-42264180 AATGAAGCTGCTCCTCCTAAAGG - Intronic
1180401290 22:12430185-12430207 AAGAAAGCTTCTACTCTGTGAGG + Intergenic
1181452802 22:23035202-23035224 CAGGAAGTTGCTTCTCCCTGGGG - Intergenic
1181644920 22:24225968-24225990 AAGCAAGGTGCTGCCCCGTGGGG + Intronic
1182575533 22:31270526-31270548 AAGGAAGTTGCTCCTGAGAGTGG + Intronic
1182623736 22:31631270-31631292 GAAGAAGCTGGTCCTCAGTGAGG - Intronic
1183789276 22:40052096-40052118 AAGGAAGCTGGTTCTAGGTGAGG - Intronic
1184599386 22:45533494-45533516 GAAGATGCTGCCCCTCCGTGGGG + Intronic
950958218 3:17077870-17077892 GAGGTAGCTGCTCCTCTCTGTGG + Intronic
951138373 3:19130965-19130987 CAGGAAGATGCTTCTCCCTGGGG - Intergenic
953610572 3:44444283-44444305 ATGGAAGCTGCACCTCTGAGAGG + Exonic
953632283 3:44629246-44629268 AAGGAAGTAGCTCCTCTGTTTGG + Exonic
954212362 3:49105009-49105031 AAGGAAGGTGTTCGTCCCTGAGG + Exonic
958214184 3:90540432-90540454 AAGGAAGCTTCAACTCTGTGAGG + Intergenic
958530915 3:95329471-95329493 ATGGATGCTGCTGCTCCTTGAGG + Intergenic
959359306 3:105368410-105368432 AAGGAACCTGCTGCTCTGTCAGG - Intronic
961323741 3:126097312-126097334 CAGGAAGTTGCTTCTCCCTGGGG + Intronic
962240201 3:133745818-133745840 GAGGGAGCAGCTCCTCCGTGGGG + Intergenic
967270049 3:187725708-187725730 AAGCAGCCTGCTCCTCCCTGAGG + Intronic
968039241 3:195574498-195574520 AAGGAAGCTGCCACTGTGTGGGG + Intronic
969627486 4:8314968-8314990 AACGAAGGTGCTCCTCATTGGGG - Intergenic
975779069 4:77819957-77819979 AAGGAAGCTGCGCCCCCGCAGGG + Intergenic
976950972 4:90829981-90830003 CAAGAAGCTGCTTCTCCCTGAGG + Intronic
985232946 4:187841275-187841297 AAGGAATCTGCTACTGCTTGGGG + Intergenic
986650510 5:9959026-9959048 CAGGAAGTTGCTTCTCCCTGGGG + Intergenic
987799523 5:22675452-22675474 AAGTTAGTTGCTCCTCCATGAGG - Intronic
987958453 5:24770931-24770953 CAGGAAGTTGCTTCTCCCTGAGG + Intergenic
990521310 5:56584096-56584118 CAGGAAGTTGCTTCTCCCTGGGG + Intronic
995598856 5:113775036-113775058 AAGGAAGCTACTGCTGGGTGTGG + Intergenic
997596945 5:135113432-135113454 CAGGAACCTGCTCCTGGGTGTGG - Intronic
1001580370 5:172794095-172794117 AAGGAAAAGGCTTCTCCGTGAGG - Intergenic
1002324060 5:178394039-178394061 AAGGAAGCAGGTGCTCAGTGTGG + Intronic
1002770028 6:282621-282643 AAGGAACCTGCACCTCCATAGGG - Intergenic
1003201490 6:3965323-3965345 CAGGAAGTTGCTTCTCCCTGGGG - Intergenic
1003218217 6:4134991-4135013 AAGCACGCTGCACCTCCCTGGGG - Intronic
1004233873 6:13856203-13856225 AAGGAAGGTGTTCCTCCACGTGG + Intergenic
1006897522 6:37480387-37480409 AAGGAAGCTGCTCCTGAGGCAGG + Exonic
1011353146 6:86445224-86445246 CAGGAAGCTTTTCCTCCTTGGGG + Intergenic
1014873566 6:126627555-126627577 TAGGAAGCTGATCTTCCATGAGG + Intergenic
1015135923 6:129870429-129870451 AAAGAAGCTGCTCCAGGGTGTGG + Intergenic
1015552979 6:134431465-134431487 AAGGAACCTGCCCCTGGGTGTGG - Intergenic
1017910610 6:158789443-158789465 ACATAAGCTGCTCCTCAGTGTGG + Intronic
1018635858 6:165858750-165858772 AAGGAAGATGCTCCTCCTTGTGG + Intronic
1025500707 7:61291069-61291091 AAGAAAGCTTCACCTCTGTGAGG - Intergenic
1025515565 7:61637293-61637315 AAGAAAGCTTCACCTCTGTGAGG - Intergenic
1025539903 7:62066119-62066141 AAGAAAGCTTCACCTCTGTGAGG - Intergenic
1026249850 7:68659893-68659915 AAGGAAGCTGAACCTCTGTGAGG - Intergenic
1032437038 7:131909144-131909166 CAGGAAGCTTTTCCTCTGTGGGG + Intergenic
1033438162 7:141352748-141352770 AAGGAGGCTGCTGCTGCCTGAGG + Intronic
1033964461 7:146958162-146958184 AAGGCAGCTGCACCTTCCTGAGG - Intronic
1034634076 7:152553655-152553677 ATGGCAGGTGCTCCTCCCTGTGG + Intergenic
1035172293 7:157023701-157023723 AATGAAGCTGATCTTCCCTGAGG - Intergenic
1035362927 7:158325204-158325226 AAGGAAGATGCTCCTGGCTGGGG - Intronic
1038399464 8:27271912-27271934 AAGGAAGCTGAGCCTCAGGGAGG + Intergenic
1041202812 8:55467305-55467327 AAGGAAGATTATCCTCAGTGGGG - Intronic
1046219296 8:111192653-111192675 CAGGAAGTTGCTTCTCCCTGGGG - Intergenic
1046739232 8:117811027-117811049 CAGGAAGCAGCTCCTCCCTTTGG - Intronic
1049983367 9:925137-925159 TACGAAGCTGACCCTCCGTGTGG - Intronic
1050986877 9:12093344-12093366 AAGGATGCTGCTCCTCAGCAAGG - Intergenic
1052180297 9:25518323-25518345 CAGGAGGCTGCTTCTCCTTGGGG - Intergenic
1052493339 9:29194064-29194086 AAGGAAGCTGCAGCTCAGAGAGG - Intergenic
1052620138 9:30898256-30898278 CAGGAAGCTGCTTCTCTCTGGGG - Intergenic
1052790096 9:32867345-32867367 AAAGAAGCTGAACCTCGGTGGGG + Intergenic
1052796044 9:32924426-32924448 CAGGAAGTTGCTTCTCCCTGGGG + Intergenic
1052821585 9:33141671-33141693 AAAGAAGCAGCTCCTCCATCAGG + Intronic
1053427870 9:38022868-38022890 AAGGGAGCTCCTGCTGCGTGGGG + Intronic
1055253651 9:74339022-74339044 CAGGAAGTTGCTTCTCCCTGGGG + Intergenic
1056754844 9:89375172-89375194 CAGGAAGCTCCTCCTCGGTGGGG - Intronic
1056895213 9:90540180-90540202 AAGGAAGCTGCACATCTCTGAGG - Intergenic
1057135108 9:92681999-92682021 GAGGAAACTCCTCCTCCCTGAGG + Intergenic
1060899015 9:127241126-127241148 ATGGAAGCTGTTCCTCCGCAGGG + Intronic
1060959218 9:127667361-127667383 AAGAAAACAGCTCCTCTGTGAGG - Intronic
1061409826 9:130414223-130414245 TGGGAAGCTCCTCCCCCGTGTGG + Intronic
1061887118 9:133596712-133596734 GAGGAGCCTGCTGCTCCGTGGGG + Intergenic
1062620331 9:137417666-137417688 GCGGAAGCTGCTCCGCCGCGTGG - Intronic
1062677393 9:137754915-137754937 CAGGAAGCGGCCCCTCAGTGAGG + Intronic
1186373096 X:8966930-8966952 CAGGAAGTTGCTTCTCTGTGGGG + Intergenic
1187084478 X:16027864-16027886 CAAGAAGCTGCTTCTCCCTGGGG - Intergenic
1191706756 X:64101965-64101987 AAGTAAGCTGCTCATAAGTGGGG - Intergenic
1194802600 X:98291133-98291155 TAGGAAGTTGCTTCTCCCTGGGG + Intergenic
1196419920 X:115510785-115510807 CAGGAAGTTGCTTCTCCCTGGGG + Intergenic
1197295698 X:124716686-124716708 CAGGAAGTTGCTTCTCCTTGGGG - Intronic
1197938058 X:131761047-131761069 CAAGAAGCTGCTTCTCCCTGGGG - Intergenic
1197939680 X:131776823-131776845 CAAGAAGCTGCTTCTCCCTGTGG - Intergenic
1199591834 X:149475046-149475068 AAGGAGCCTGCTCCTAAGTGTGG - Intergenic