ID: 1147123585

View in Genome Browser
Species Human (GRCh38)
Location 17:38351383-38351405
Sequence GGGAATGTATGCACATATAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 161}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147123585_1147123594 27 Left 1147123585 17:38351383-38351405 CCTATATATGTGCATACATTCCC 0: 1
1: 0
2: 1
3: 21
4: 161
Right 1147123594 17:38351433-38351455 CACATTTATCAGTACAGCACTGG 0: 1
1: 0
2: 2
3: 26
4: 253
1147123585_1147123595 28 Left 1147123585 17:38351383-38351405 CCTATATATGTGCATACATTCCC 0: 1
1: 0
2: 1
3: 21
4: 161
Right 1147123595 17:38351434-38351456 ACATTTATCAGTACAGCACTGGG 0: 1
1: 0
2: 2
3: 33
4: 187
1147123585_1147123588 -2 Left 1147123585 17:38351383-38351405 CCTATATATGTGCATACATTCCC 0: 1
1: 0
2: 1
3: 21
4: 161
Right 1147123588 17:38351404-38351426 CCGTTCTCCCCCCAGAGAGCTGG 0: 1
1: 0
2: 1
3: 17
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147123585 Original CRISPR GGGAATGTATGCACATATAT AGG (reversed) Intergenic
900464543 1:2818850-2818872 AGGCACGTATGCACATGTATAGG - Intergenic
903888117 1:26552954-26552976 GGGTAGGAATGAACATATATCGG - Intronic
904950824 1:34237303-34237325 GGGAATGAATGCACAGCTACAGG + Intergenic
906746511 1:48225683-48225705 GGGCATGTATGAACATGTGTGGG - Intronic
907156499 1:52339648-52339670 GGGAATATAAGCACATAGAGGGG + Intronic
907620290 1:55971139-55971161 GTAAATGAATGCACATAAATTGG - Intergenic
908129839 1:61064186-61064208 GGTAATGTATGCACATCTTCAGG - Intronic
908527507 1:65002185-65002207 GTGTATATATGCACATATATGGG + Intergenic
908701678 1:66908947-66908969 GAGAATATAGGCACAGATATAGG - Intronic
908936318 1:69381311-69381333 GGGAACACATGCACATATTTTGG - Intergenic
909693844 1:78441645-78441667 AGATATATATGCACATATATGGG - Intronic
911499557 1:98668201-98668223 AGGAATGTTTGCACATAAAATGG - Intronic
911644583 1:100324697-100324719 GTGCATGTATACATATATATTGG + Intergenic
916472732 1:165139796-165139818 GGGAATGTATGCAGATATCAAGG + Intergenic
918609414 1:186470530-186470552 GGAAATGTACACACATACATAGG - Intergenic
919002316 1:191848259-191848281 GTGTATGTATGTACATATATAGG - Intergenic
921771617 1:219047329-219047351 GGGAATATACACAAATATATAGG - Intergenic
923351292 1:233109189-233109211 GGAAATGTATGCACATTTTCAGG + Intronic
923967829 1:239162525-239162547 GGGAATGTGTTTATATATATTGG + Intergenic
1064917356 10:20474866-20474888 GGGAATGTATATATATTTATAGG - Intergenic
1068503398 10:57868534-57868556 GGGTATATATGGATATATATGGG + Intergenic
1068644082 10:59446061-59446083 TGTACTGTATGCACATATTTTGG - Intergenic
1069662000 10:70129475-70129497 CGGTATGTATACACATATACAGG + Intronic
1073947215 10:108765146-108765168 AGGAATGTATGCAGGTATTTGGG - Intergenic
1074494152 10:113964399-113964421 GGGAAGGTAGGCACATTTAGGGG - Intergenic
1075923120 10:126229584-126229606 GGGAGAGAATGCACATGTATAGG - Intronic
1078655279 11:13233081-13233103 GGGAATATATACATACATATAGG + Intergenic
1079445702 11:20554547-20554569 GAGAATGTAAGCACCTATGTTGG - Intergenic
1081244073 11:40742602-40742624 GGGTAATTATGCACATATAATGG - Intronic
1082223825 11:49676744-49676766 AGGAATGGATGCACTTATCTGGG + Intergenic
1084792719 11:71484829-71484851 GTGAATGTATGCACAAGTGTGGG + Intronic
1086625224 11:88942454-88942476 AGGAATGGATGCACTTATCTGGG - Intronic
1087111371 11:94472785-94472807 TGGAATATTTGCACATATGTTGG - Intronic
1087489019 11:98799607-98799629 TGGAATGTACACACATATATGGG + Intergenic
1094075082 12:26463934-26463956 GGGAAAATATGCACAGAGATGGG - Intronic
1094119320 12:26952535-26952557 GGAAATGTCTGATCATATATTGG + Intronic
1094230608 12:28098544-28098566 CGAGATGTATGCACACATATAGG + Intergenic
1099610705 12:84865371-84865393 AGGAGGTTATGCACATATATTGG - Intronic
1100123970 12:91401358-91401380 GGAAATGTGTGCAATTATATTGG + Intergenic
1102695622 12:114797110-114797132 GGGCATGTGTGCACAGATCTTGG - Intergenic
1102810895 12:115823366-115823388 GCAAATGTATGTAAATATATGGG - Intergenic
1104485304 12:129146658-129146680 GGAAATGTGTGCAAACATATGGG - Intronic
1106085037 13:26534289-26534311 AGAAATGTCTTCACATATATGGG + Intergenic
1106704169 13:32262844-32262866 GTGGGTGTATGCACATATTTGGG + Intronic
1108799144 13:54071315-54071337 GGCACTGTATCCACATAAATTGG - Intergenic
1109671085 13:65608683-65608705 GAGGATGTATACACACATATGGG - Intergenic
1112668453 13:101605284-101605306 GCGTATATATACACATATATAGG + Intronic
1112668455 13:101605368-101605390 GCGTATATATACACATATATGGG + Intronic
1112891879 13:104244951-104244973 TGCAATATATACACATATATAGG + Intergenic
1113090169 13:106609772-106609794 GGGAATATGTGCACATAAATGGG - Intergenic
1113543028 13:111123530-111123552 TGGACTGTATTTACATATATCGG - Intronic
1117662256 14:58019964-58019986 GGGAATTTATGCATATATCTGGG - Intronic
1122011027 14:98747244-98747266 TGAAATATATGCACATATATAGG - Intergenic
1124601365 15:31135205-31135227 CAGAATGTGTGCACATATCTAGG - Intronic
1126844993 15:52751189-52751211 GGGAAAGTATTTACATCTATGGG + Intergenic
1127680594 15:61293023-61293045 AGGAATATATGCACATGTAAGGG + Intergenic
1128998613 15:72315505-72315527 GAGCATGTATGCAGATACATGGG - Intronic
1130217780 15:81988454-81988476 GGGAGTGTATGCAGAAATTTAGG + Intergenic
1139806427 16:69567980-69568002 GGGAATATATTCACAAATATGGG + Intronic
1147123585 17:38351383-38351405 GGGAATGTATGCACATATATAGG - Intergenic
1149171159 17:53812984-53813006 GGAAATGTGTGTACATATAAAGG - Intergenic
1151278632 17:73055262-73055284 GGGAGTTCATGCACATATTTGGG + Intronic
1153118694 18:1693127-1693149 GTGTATATATGCATATATATTGG + Intergenic
1156563944 18:38162576-38162598 TGGAATATATAGACATATATAGG + Intergenic
1157461547 18:47901105-47901127 CACAATGGATGCACATATATAGG - Intronic
1157932206 18:51835435-51835457 GGGAATGTATGGAGGTATTTTGG - Intergenic
1158013498 18:52756475-52756497 GTTTATGTATGCACATATATGGG - Intronic
1159220293 18:65453793-65453815 GGGAATGGATGAACAAATTTTGG + Intergenic
926071636 2:9898678-9898700 GGAAATGTAGACACATATCTTGG + Intronic
926364817 2:12123342-12123364 GGGAATATATAGATATATATGGG - Intergenic
927144439 2:20153268-20153290 GGAAATTCATGCAGATATATGGG - Intergenic
930710477 2:54546421-54546443 GTGTGTGTATGCACATATACAGG - Intronic
933126610 2:78616249-78616271 GGAAATATATGTAAATATATAGG - Intergenic
934162455 2:89264030-89264052 GTGTGTGTATGCATATATATAGG - Intergenic
934162459 2:89264657-89264679 GTGTTTGTATGCATATATATAGG + Intergenic
934204815 2:89918059-89918081 GTGTTTGTATGCATATATATAGG - Intergenic
934204819 2:89918320-89918342 GTGTGTGTATGCATATATATAGG + Intergenic
934618993 2:95792678-95792700 GGGAATGGATGCACTGGTATTGG + Intergenic
934641898 2:96031879-96031901 GGGAATGGATGCACTGGTATTGG - Intronic
934886347 2:98028840-98028862 GGGAATATATGTACATTTATAGG - Intergenic
937482270 2:122274806-122274828 GTGCATATATGCATATATATAGG - Intergenic
937484227 2:122297342-122297364 GGGAATGGATGCATAAATATGGG + Intergenic
943619058 2:190127271-190127293 CAGAATGAATGCTCATATATCGG + Intronic
944123919 2:196271843-196271865 TGGAATGTAAGCACCTATAGTGG - Intronic
944326352 2:198409240-198409262 GTGAATATATATACATATATAGG + Intronic
946143077 2:217707990-217708012 TGGAATGTATGCACATCTAATGG - Intronic
946669093 2:222083273-222083295 ATGAATGTATGCATATTTATGGG - Intergenic
1169711570 20:8570382-8570404 GGTAATATATGAATATATATAGG + Intronic
1169739095 20:8870495-8870517 TGGAATATATGCATATATAGAGG + Intronic
1171170194 20:23009321-23009343 GTGTATATATGTACATATATAGG - Intergenic
1171302324 20:24074207-24074229 GGATATGAATACACATATATAGG + Intergenic
1173556372 20:43969056-43969078 TGGAATGTTTGTACACATATGGG + Intronic
1174775165 20:53336954-53336976 GTGTATGTATACACATATATAGG - Intronic
1174786954 20:53441895-53441917 GAGAATGTTTGCACATTTAAAGG - Intronic
1175588187 20:60163185-60163207 GGGAACGTGTGGACATATTTAGG + Intergenic
1177694422 21:24553915-24553937 GGGAATGTTTGGTCAAATATGGG - Intergenic
1179285305 21:39972888-39972910 CTGAATGTTTGCACAGATATTGG - Intergenic
956971793 3:74534916-74534938 GGAATGGTATGCACATAAATTGG + Intergenic
957678881 3:83405567-83405589 GATAATGTATGTACATATATTGG - Intergenic
958488001 3:94736166-94736188 GACAATATATGCAAATATATTGG - Intergenic
959455371 3:106553806-106553828 GTGCATGTATGAATATATATAGG - Intergenic
959937519 3:112044763-112044785 GTGAATCTCTGCAGATATATTGG - Intronic
962295286 3:134178248-134178270 GGGGATATATGCACATATATAGG - Intronic
963193536 3:142500990-142501012 GAGAATGTATCCACATAAATGGG + Intronic
963751988 3:149190239-149190261 AGGAATATAACCACATATATAGG + Intronic
965191975 3:165542496-165542518 GTGTATGTATGCGCATATGTTGG + Intergenic
965544265 3:169899258-169899280 TTGGATGTATGCATATATATGGG + Intergenic
965868379 3:173234762-173234784 GTAAAAGTATGCAAATATATAGG - Intergenic
965998836 3:174921901-174921923 CAGAATGTTTGCACATAGATTGG + Intronic
967148785 3:186629167-186629189 TGGAAAGTATTCACACATATAGG - Intergenic
967229597 3:187324872-187324894 GGAAATGTATGCACACACAGAGG + Intergenic
967697524 3:192550332-192550354 ATATATGTATGCACATATATAGG - Intronic
969039935 4:4288316-4288338 GTGAATTTATGAACATAAATGGG - Intronic
969486599 4:7475660-7475682 GTGCATGTATGCACATGTACAGG - Intronic
971914112 4:32845483-32845505 GTTAATATATGCACATATATTGG - Intergenic
974448186 4:62014038-62014060 GGGAAGGTATGAACATGAATTGG + Intronic
974510642 4:62835847-62835869 GGGAATATATTCAAATATGTGGG - Intergenic
978541317 4:109818889-109818911 TAGAATGTATGGATATATATAGG - Intronic
978596228 4:110379902-110379924 GAGAATGTATGCACAGACACTGG + Intronic
978863476 4:113479680-113479702 GGGTATTTATGCACATAGGTTGG + Intronic
979493653 4:121359755-121359777 GGGAGTGTATATATATATATAGG + Intronic
979522735 4:121687420-121687442 GGGAATGTAAAAACATTTATTGG - Intronic
981086824 4:140692139-140692161 GTGTATGTATGCACATGTGTAGG + Intronic
984345856 4:178524265-178524287 GGTAATGTATTCACATATTCTGG - Intergenic
984716730 4:182933011-182933033 GGCAATGTGTGCAGATATGTAGG + Intergenic
985867046 5:2522216-2522238 GGGATCATATGCACATATTTTGG + Intergenic
986726595 5:10602516-10602538 GGCAATGTTTTCACAAATATTGG - Intronic
987443921 5:17992697-17992719 AGAAATGTATCCAGATATATAGG + Intergenic
989823295 5:45821974-45821996 GGTAATGTATGCATATACATAGG - Intergenic
992200072 5:74374506-74374528 GGGAATGTATGTATATTTACTGG - Intergenic
993548199 5:89239822-89239844 GGGAATGTATGTGCATATTTTGG + Intergenic
995947461 5:117666004-117666026 GGAAATGATTGCACATATAGTGG + Intergenic
996135388 5:119835400-119835422 GTGAATGAATACACAAATATTGG - Intergenic
997232444 5:132254565-132254587 GGGAAGGTATCCTCAAATATGGG + Intronic
997381444 5:133441046-133441068 GGAATTGAATGCAAATATATTGG + Intronic
998255028 5:140578833-140578855 GGGAAAATATGCAGATGTATGGG + Intronic
998531871 5:142892526-142892548 GGTAATGTATGTACAGCTATGGG + Intronic
999540136 5:152562216-152562238 GAGAATATTTGCACATCTATGGG + Intergenic
1000675307 5:164114971-164114993 GGGCATGTAAGCACCTTTATGGG + Intergenic
1004949291 6:20650417-20650439 AGGAATGTAAACAGATATATAGG - Intronic
1009296166 6:61950904-61950926 GGAAATGTATGTACAAATTTGGG + Intronic
1009925805 6:70119283-70119305 GAGACTGTATGAACATAGATGGG + Intronic
1011051083 6:83150291-83150313 GGGAATGTATGTACAGGTGTTGG + Intronic
1011060347 6:83259008-83259030 GGAAATATATGAACAGATATTGG + Intronic
1017097614 6:150818654-150818676 AGAAATATATGCACATATGTGGG - Intronic
1018379515 6:163245580-163245602 GGGAATGAATGCAGATAAATAGG - Intronic
1020829059 7:13070442-13070464 AGGTATGTATATACATATATAGG + Intergenic
1021934786 7:25619303-25619325 GGGCATATTTGCACACATATGGG - Intergenic
1024178296 7:46862907-46862929 TGGGACCTATGCACATATATGGG - Intergenic
1024994119 7:55258260-55258282 CGGAATGTATACACCTATTTGGG + Intergenic
1025481072 7:60983540-60983562 GAGGATGGATGCACTTATATAGG - Intergenic
1028263454 7:88693048-88693070 AGAAATGTATGCACCAATATTGG + Intergenic
1029104022 7:98159688-98159710 TGGAAAGTATGGACAAATATTGG - Intronic
1030882898 7:114903467-114903489 GGGAGTTTATGTATATATATAGG - Intergenic
1031117833 7:117687492-117687514 GGGAATTTCTGCTCAAATATAGG - Intronic
1031413671 7:121470119-121470141 GTATATGTATGCATATATATAGG + Intergenic
1031466272 7:122116169-122116191 GGGATGGTCTGCACTTATATAGG + Intronic
1035695149 8:1590423-1590445 CGGAATGTATGGTCAAATATAGG + Intronic
1038090132 8:24243331-24243353 TGCACTGTATGCACATAAATAGG - Intergenic
1039605827 8:38879729-38879751 GGGTATATATACATATATATGGG + Intergenic
1042951875 8:74208736-74208758 GTGAATGAATCCACTTATATGGG - Intergenic
1045313634 8:101025376-101025398 TGGAATTTATCCTCATATATTGG + Intergenic
1045652146 8:104351294-104351316 GTGTGTGTATGCACATGTATGGG + Intronic
1046426677 8:114061368-114061390 GTGAATGTATTCATATATCTGGG - Intergenic
1047700239 8:127442418-127442440 GGGAATGTGGGCACTTATGTCGG - Intergenic
1051227089 9:14910667-14910689 GAGAATGCATGCACATGTGTGGG - Intronic
1051294012 9:15575609-15575631 GGGAATCTGTGAACATAGATGGG + Intronic
1052000472 9:23272799-23272821 AGAAATGTATGAACAGATATAGG - Intergenic
1055342431 9:75298416-75298438 AGGTATGTATGAATATATATGGG + Intergenic
1059208886 9:112492548-112492570 AGGTATGTATGTACATATGTAGG - Intronic
1059738471 9:117126228-117126250 TGGGATGTCTGCACATACATAGG - Intronic
1062118986 9:134823885-134823907 GGGTATGCATGCATATATGTGGG + Intronic
1186297352 X:8165007-8165029 GGTAATATATTCACATATAGGGG + Intergenic
1186376850 X:9012249-9012271 GGTAATATATTCACATATAGGGG - Intergenic
1190252552 X:48737965-48737987 GGGAATGAATGCCCATTAATGGG - Intergenic
1190548699 X:51556842-51556864 GGGAAAATATGCACATGTATGGG - Intergenic
1192198201 X:69046346-69046368 GGGGATGTGTGCACATAGATTGG + Intergenic
1193504792 X:82328922-82328944 AGGAATATATACATATATATAGG - Intergenic
1193792721 X:85835299-85835321 GAGAATGTCTGAACATATAGTGG + Intergenic
1194891322 X:99383701-99383723 GAGAATATATGGACATATAGAGG + Intergenic
1198126732 X:133651945-133651967 GTGCATGTACGCACATATAAGGG + Intronic
1199383630 X:147199191-147199213 GCTAATGTATACACCTATATAGG - Intergenic
1199950130 X:152700104-152700126 GGGAATGTATGGCCAGATGTGGG + Intronic
1199959545 X:152768357-152768379 GGGAATGTATGGCCAGATGTGGG - Intronic