ID: 1147128459

View in Genome Browser
Species Human (GRCh38)
Location 17:38390493-38390515
Sequence TTGAGTCAGTACATCAATTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1287
Summary {0: 1, 1: 2, 2: 21, 3: 205, 4: 1058}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147128456_1147128459 0 Left 1147128456 17:38390470-38390492 CCCATGTTGGCAAGAGTGTGGAG 0: 1
1: 2
2: 14
3: 81
4: 321
Right 1147128459 17:38390493-38390515 TTGAGTCAGTACATCAATTTGGG 0: 1
1: 2
2: 21
3: 205
4: 1058
1147128453_1147128459 2 Left 1147128453 17:38390468-38390490 CCCCCATGTTGGCAAGAGTGTGG 0: 1
1: 1
2: 0
3: 10
4: 142
Right 1147128459 17:38390493-38390515 TTGAGTCAGTACATCAATTTGGG 0: 1
1: 2
2: 21
3: 205
4: 1058
1147128457_1147128459 -1 Left 1147128457 17:38390471-38390493 CCATGTTGGCAAGAGTGTGGAGT 0: 1
1: 0
2: 2
3: 19
4: 151
Right 1147128459 17:38390493-38390515 TTGAGTCAGTACATCAATTTGGG 0: 1
1: 2
2: 21
3: 205
4: 1058
1147128451_1147128459 20 Left 1147128451 17:38390450-38390472 CCTACTGAGATTTTAATACCCCC 0: 1
1: 0
2: 0
3: 6
4: 148
Right 1147128459 17:38390493-38390515 TTGAGTCAGTACATCAATTTGGG 0: 1
1: 2
2: 21
3: 205
4: 1058
1147128455_1147128459 1 Left 1147128455 17:38390469-38390491 CCCCATGTTGGCAAGAGTGTGGA 0: 1
1: 1
2: 21
3: 106
4: 585
Right 1147128459 17:38390493-38390515 TTGAGTCAGTACATCAATTTGGG 0: 1
1: 2
2: 21
3: 205
4: 1058

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147128459 Original CRISPR TTGAGTCAGTACATCAATTT GGG Intronic
900296322 1:1952984-1953006 TTGAATCTATAGATCAATTTGGG - Intronic
900457017 1:2780824-2780846 TTGAATCTGTAGATCACTTTGGG + Intronic
900842109 1:5060358-5060380 TTAAATCTGTAAATCAATTTGGG - Intergenic
900848921 1:5126639-5126661 ATGAGCCAGTTTATCAATTTGGG - Intergenic
900904322 1:5541397-5541419 TTGAGTCTGTAGATCACTTTGGG - Intergenic
901172665 1:7272322-7272344 TTGAATCTGTAGATCAATTTGGG - Intronic
901313455 1:8288394-8288416 TTGAATCTGTAGATCAATTTGGG + Intergenic
902967224 1:20014542-20014564 TTGAATCTGTAGATCACTTTGGG + Intergenic
903150959 1:21408418-21408440 TTGAATCTATAGATCAATTTGGG + Intergenic
904537758 1:31211555-31211577 TTGAATCTGTAGATCAATTTGGG - Intronic
904776274 1:32909031-32909053 TTGAATCTGTAGATCAATTTGGG - Intergenic
904854160 1:33483771-33483793 TTGAATCTGTAGATCAAATTGGG + Intronic
904859949 1:33528954-33528976 TTGAACCTGTAGATCAATTTGGG - Intronic
905100480 1:35517133-35517155 TTGAGTCTGTAAATTGATTTGGG - Intronic
905135948 1:35799940-35799962 TTGAATCTGTAAGTCAATTTGGG - Intergenic
905157162 1:35994905-35994927 TTGAGTTTATAGATCAATTTGGG - Intronic
905558459 1:38906835-38906857 TTAAATCTGTACATCAATTTGGG - Intronic
905713795 1:40130771-40130793 TTGAATCTGCAGATCAATTTGGG + Intergenic
905966356 1:42100642-42100664 TTGAATCTGTAGATCAATTTGGG - Intergenic
907070363 1:51529077-51529099 CTGAATCAGTAGATCAATTTGGG - Intergenic
907073489 1:51558517-51558539 ATGAGCCAGTTTATCAATTTGGG - Intergenic
907083440 1:51646184-51646206 TTGAATCTGTAAATCAATTTAGG + Intronic
907342567 1:53747246-53747268 TTGAGTCTCTAGATTAATTTGGG - Intergenic
907389532 1:54149056-54149078 TTGAGTTAGCACATAAATTAAGG + Intronic
907567941 1:55454581-55454603 TTGTATCTGTAGATCAATTTGGG - Intergenic
907795804 1:57715859-57715881 TTGAGTCTGTAGATTGATTTGGG - Intronic
908012693 1:59797333-59797355 CTGAATCTGTAGATCAATTTGGG + Intergenic
909248590 1:73322971-73322993 TTGAATCTGTAGATCTATTTGGG + Intergenic
909333371 1:74442524-74442546 TTGAATTATTAGATCAATTTGGG + Intronic
909684623 1:78333475-78333497 TTGATTAAATAAATCAATTTAGG + Intronic
910025839 1:82650529-82650551 TTGAATCTGTAGATCAATTTGGG - Intergenic
910372668 1:86533652-86533674 TTGAATCTATACATCAAGTTGGG + Intergenic
910458860 1:87426704-87426726 TTGAGGCAATCCATGAATTTTGG - Intergenic
910610644 1:89138230-89138252 TTGAATATGTAAATCAATTTGGG - Intronic
910932255 1:92454337-92454359 TTGAATCTATAAATCAATTTGGG + Intergenic
911250068 1:95565559-95565581 TTGAATCTATAGATCAATTTGGG + Intergenic
911266237 1:95747287-95747309 TTGAATCTGTAGATCATTTTGGG + Intergenic
911280352 1:95919280-95919302 TTGAATCTATACATTAATTTAGG - Intergenic
911313257 1:96323844-96323866 TTGAATCTGTAGATCACTTTGGG - Intergenic
911333061 1:96547727-96547749 TTTTGTCAGTAGATGAATTTTGG - Intergenic
911631072 1:100184031-100184053 TTGAATCTGTAGATCACTTTGGG + Intergenic
911771758 1:101751993-101752015 TTGAATCTGTAGATCACTTTTGG + Intergenic
911992512 1:104719609-104719631 TTGAATCTATACATCAATTTGGG - Intergenic
912148727 1:106829196-106829218 TTGAATCTGTAGATCACTTTGGG - Intergenic
912408104 1:109459121-109459143 TTAAATCTGTAGATCAATTTAGG - Intergenic
912592790 1:110843641-110843663 TTGAATCTGTAGATCACTTTGGG + Intergenic
912784574 1:112587881-112587903 CTGAATCCGTAGATCAATTTAGG + Intronic
913028134 1:114867320-114867342 TTGAATCTGTAGATCAAGTTGGG + Intronic
913083948 1:115416844-115416866 TTGAATCTGTACATCAGTGTGGG - Intergenic
913366973 1:118049598-118049620 TTGAATCTGTAGATCACTTTGGG - Intronic
913395724 1:118369727-118369749 TTAAGTCTGTAGATCAATTTAGG + Intergenic
913425637 1:118725979-118726001 TTGAATCTGTACATTACTTTGGG - Intergenic
913431300 1:118795053-118795075 TTGAATTTGTACATCACTTTGGG - Intergenic
913496926 1:119436365-119436387 TGGAGTCAGAAAATCAATTAGGG + Intergenic
913523870 1:119671895-119671917 TTGGATCTGTACATCAATTTAGG + Intronic
914412515 1:147444706-147444728 TTGAATCTGTAGATCACTTTGGG + Intergenic
915423913 1:155807871-155807893 TTGAATCTGTAGATCAATTTGGG + Intronic
915772290 1:158439965-158439987 TTGAATCTGTAGATCACTTTGGG - Intergenic
915780077 1:158538646-158538668 TTGAATCTGTATATGAATTTGGG + Intergenic
915867707 1:159522083-159522105 TTGAGTCTGTACATTGCTTTGGG + Intergenic
916453481 1:164945040-164945062 TTGAATCTGTAAATCACTTTGGG + Intergenic
916559591 1:165922250-165922272 TTGAATCCATAGATCAATTTGGG + Intergenic
916916497 1:169412448-169412470 TTGAATCAGTAAATTACTTTGGG - Intronic
917008332 1:170441407-170441429 TTGAATCTATAGATCAATTTGGG - Intergenic
917221748 1:172737994-172738016 TTGAATCTGTAGATCACTTTGGG + Intergenic
917411532 1:174764460-174764482 TTGAGGCAGCACATCATATTGGG - Intronic
918025361 1:180739495-180739517 TTAAATCTGTAGATCAATTTAGG + Intronic
918183200 1:182103232-182103254 TTGAATCTGTAGATCAGTTTTGG + Intergenic
918196150 1:182223787-182223809 TTGAATCTGTAAATCACTTTGGG - Intergenic
918731562 1:188003536-188003558 TTGAATCTGTAGATTAATTTGGG + Intergenic
918925867 1:190785169-190785191 TTGAATCTGTACATTACTTTGGG - Intergenic
918947044 1:191079803-191079825 TTGAATCTGTAGATTAATTTGGG - Intergenic
919089771 1:192964110-192964132 TTGAATCTGTAGATCACTTTGGG - Intergenic
919155477 1:193759939-193759961 TTGATTCAATAAGTCAATTTTGG - Intergenic
919295357 1:195692219-195692241 TTGAATCTGTAGATCACTTTGGG - Intergenic
919508254 1:198427583-198427605 TTGAATGGGAACATCAATTTAGG + Intergenic
919577304 1:199326971-199326993 TTGAATCTGTAGATCACTTTGGG - Intergenic
919717051 1:200789725-200789747 TTGAATCTGTAGATCAAGTTGGG + Intronic
920168286 1:204052126-204052148 TTGAATCTATATATCAATTTTGG + Intergenic
920590486 1:207213530-207213552 TTGACTCTGTAGATCAATTTGGG + Intergenic
920803872 1:209214830-209214852 TTGAGTCTGTACATTGCTTTGGG + Intergenic
921683112 1:218057766-218057788 TTGAATCTGTAAATCAATTTGGG + Intergenic
921701857 1:218277806-218277828 TTGAATCTGTAGGTCAATTTGGG + Intergenic
921778941 1:219138018-219138040 TTGAATCAATAAATCACTTTGGG - Intergenic
921784519 1:219213484-219213506 TTAAACCTGTACATCAATTTGGG + Intergenic
922549940 1:226487255-226487277 TTGAATCTGTAGATCACTTTGGG + Intergenic
922637062 1:227184787-227184809 CTAAGTCTGTAGATCAATTTGGG + Intronic
923100590 1:230812065-230812087 TTGAATCTGTAGATCACTTTGGG + Intergenic
923138928 1:231143788-231143810 TTGAATCTGTAGATCACTTTGGG - Intergenic
923175295 1:231457959-231457981 TTGAATCTGTAGATCACTTTGGG - Intergenic
923696850 1:236261710-236261732 TTGAATCTGTAGATCACTTTAGG - Intronic
923802463 1:237223460-237223482 TTAAGGCATTAAATCAATTTTGG + Intronic
923932334 1:238716119-238716141 TTATTTCAGTATATCAATTTTGG + Intergenic
924083372 1:240422313-240422335 ATGAGTCAATAAATCAAGTTGGG + Intronic
924389840 1:243542106-243542128 TTGAATCTGTAGATAAATTTAGG - Intronic
924496985 1:244600062-244600084 TTGAGTCACTCCCTCAACTTAGG + Intronic
1062891712 10:1066525-1066547 TTAAATCTGTACATCAATCTGGG - Intronic
1063147929 10:3313352-3313374 TTGAGACAGAACATTGATTTGGG - Intergenic
1063263722 10:4421768-4421790 GTGAATCAATACATCAAGTTGGG - Intergenic
1063852118 10:10204229-10204251 TTGAATCTGTAGATCACTTTGGG + Intergenic
1064108014 10:12516950-12516972 TCGAATCTGTACATCAACTTTGG + Intronic
1064507273 10:16046631-16046653 TTGACTCAGTAGATCAAATTGGG + Intergenic
1065241104 10:23705828-23705850 TTTAGTCTATAGATCAATTTGGG + Intronic
1065277703 10:24102464-24102486 TTGAATCTATACATCAAGTTGGG - Intronic
1065365531 10:24932708-24932730 TTGAATCTATAGATCAATTTGGG - Intronic
1065758215 10:28954847-28954869 TTGAATCTGTAGATCAATCTGGG - Intergenic
1065806873 10:29401496-29401518 TTGAGTCTGTAGATCAATTTGGG - Intergenic
1065941700 10:30570384-30570406 TTGAGTCTATAGATCAAGTTGGG + Intergenic
1066748572 10:38628916-38628938 TTGAATCTGTAGATCACTTTGGG - Intergenic
1066968104 10:42288858-42288880 TTGAATCTGTAGATCACTTTTGG + Intergenic
1067086880 10:43246334-43246356 TTGAATCTGTAGGTCAATTTGGG - Intronic
1067264537 10:44726990-44727012 TTGAATCTGTAGATCAATGTAGG + Intergenic
1067336668 10:45372342-45372364 TTGAAGCTGTAGATCAATTTGGG - Intergenic
1067454130 10:46402774-46402796 TTGAATCTGTAGACCAATTTGGG + Intergenic
1067633070 10:47981856-47981878 TTGAATCTGTAGACCAATTTGGG - Intergenic
1068158230 10:53228750-53228772 TTGAATCTGTAAATCACTTTGGG - Intergenic
1068290911 10:55000771-55000793 TTCAGTCAGTCCCTCCATTTGGG + Intronic
1068424648 10:56844356-56844378 TTGAATAAATAGATCAATTTTGG - Intergenic
1068548016 10:58373417-58373439 TTGAATCTGTAGAGCAATTTTGG + Intergenic
1068758959 10:60686005-60686027 TTGAGTTTATAGATCAATTTTGG - Intronic
1069289056 10:66753956-66753978 TTGAATCTGTAGATCAGTTTGGG - Intronic
1069408844 10:68131443-68131465 TTGAATCTGTATATCAATTTAGG + Intronic
1070004164 10:72406404-72406426 TTGAGTATGTAGATCAATTTGGG - Intronic
1070072902 10:73106952-73106974 TTGAATCTGTAGATCAATTTGGG + Intergenic
1070098468 10:73361805-73361827 TTCAATCTGTAGATCAATTTGGG - Intergenic
1070854797 10:79599080-79599102 TTGAATCTGTAGATCACTTTGGG - Intergenic
1070894424 10:79970437-79970459 TTGAATCTGTAGATCATTTTTGG + Intronic
1071036638 10:81255312-81255334 CTGAATCTGTAGATCAATTTGGG + Intergenic
1071618946 10:87100931-87100953 TTGAATCTGTAGATCAATTTGGG + Intronic
1071775545 10:88783543-88783565 TTGTCTCACTGCATCAATTTTGG + Intergenic
1071776751 10:88797690-88797712 TTGACTCAGTACAACAGTTTTGG + Intergenic
1072123778 10:92427842-92427864 TTGAGTCTATAGATCAAGTTGGG - Intergenic
1072174543 10:92905342-92905364 TTGAATCTGTAGATCAAGTTGGG + Intronic
1072366010 10:94710445-94710467 TTGAATCTGTAGATCAATTTGGG + Intronic
1072609613 10:97008723-97008745 TTGAATCTGTAGATCAATTTAGG - Intronic
1072837530 10:98732207-98732229 TTGAATCTATAAATCAATTTAGG - Intronic
1072975991 10:100058604-100058626 TTGAATCTGTAGATCACTTTGGG - Intronic
1073012003 10:100367847-100367869 TTGAATCTGTAGATCAATTTGGG - Intergenic
1073279093 10:102338919-102338941 TTGAGTCTATAGATCAATTTGGG - Intronic
1073365073 10:102933198-102933220 TTGCATCTGTAGATCAATTTAGG + Intronic
1073547288 10:104361488-104361510 TTAATTCAGTCTATCAATTTAGG + Intronic
1073924505 10:108499510-108499532 TCAAGTAAGTACATGAATTTAGG - Intergenic
1073974068 10:109079659-109079681 TTGAATCTGTAGATCAATTGGGG + Intergenic
1074055212 10:109917551-109917573 TTGAGTCCATAGATCAATTTGGG - Intronic
1074173557 10:110971612-110971634 TTGAATCTGTAGATCACTTTGGG + Intronic
1074234757 10:111574058-111574080 TTTAGTAAGTACATAAATTTGGG - Intergenic
1074489385 10:113925553-113925575 TTGAATCTGTAGATCAGTTTGGG + Intergenic
1074619202 10:115100803-115100825 TTGAGTCTATAGATCAATTTTGG + Intronic
1075422662 10:122314131-122314153 TTGAATATGTAGATCAATTTGGG + Intronic
1075490280 10:122861508-122861530 TTGAATCTGTAGATCAAATTGGG + Intronic
1076099707 10:127766319-127766341 ATGAGTCAGTTTATCAATCTGGG + Intergenic
1076352612 10:129828253-129828275 CTGAATCTGTAGATCAATTTTGG + Intergenic
1076669950 10:132114666-132114688 TTGAATCTATAGATCAATTTGGG + Intronic
1076699256 10:132261868-132261890 TTGAATCAGTAGATTACTTTGGG - Intronic
1076770598 10:132661607-132661629 CTGAATCTTTACATCAATTTGGG - Intronic
1076991061 11:274610-274632 TTGAATCTGTAGATCGATTTGGG + Intergenic
1077258379 11:1600605-1600627 TAGACTCTGTAGATCAATTTTGG + Intergenic
1077753019 11:4994185-4994207 TTGAATCTGTAGATCGATTTGGG - Intergenic
1078124648 11:8548673-8548695 TTGAATCTGTAGATCACTTTGGG + Intronic
1078150332 11:8753485-8753507 TTGAGTCTGTAAATCAATTTAGG - Intronic
1078343297 11:10518098-10518120 TTGAATAAATATATCAATTTAGG - Intronic
1078410433 11:11111332-11111354 TTGAATCTGTACACCAATTTGGG - Intergenic
1078881604 11:15454835-15454857 TTGAATCTATAGATCAATTTGGG + Intergenic
1079547633 11:21653370-21653392 TTGAGTAAGTACATGAACTTTGG - Intergenic
1080115740 11:28619644-28619666 TTCAGTCAGCACAACAATGTAGG - Intergenic
1080506696 11:32921702-32921724 TTGAATCTAAACATCAATTTGGG - Intronic
1081063708 11:38512483-38512505 TTCAATCTGTACATCACTTTGGG + Intergenic
1081624298 11:44638974-44638996 CTGAATCTGTAAATCAATTTGGG - Intergenic
1081642811 11:44768168-44768190 TTGAATCTGTATATCAAGTTGGG + Intronic
1081985434 11:47299235-47299257 TTGAATCTGTAGATCACTTTTGG + Intronic
1082745622 11:56958626-56958648 TTAAACCTGTACATCAATTTGGG + Intergenic
1084339409 11:68484953-68484975 TTGAATCTGTAGATCAAGTTAGG + Intronic
1084467088 11:69330136-69330158 TTGAATCTGTAGATCCATTTTGG + Intronic
1084803140 11:71559382-71559404 TAGACTCTGTAGATCAATTTTGG - Intronic
1084886691 11:72214275-72214297 TTGAATCTGTAGATCAGTTTGGG - Intergenic
1084990437 11:72917968-72917990 TTGAATCTGTAGATCACTTTGGG + Intronic
1085106541 11:73848513-73848535 TTGAATCTGTAGATCAATTTGGG + Intronic
1085589346 11:77743301-77743323 TTGAATCTGTAGATCACTTTGGG + Intronic
1085753304 11:79182018-79182040 TTGAGTCTATAGATAAATTTGGG - Intronic
1086273747 11:85098970-85098992 GGGAGTCAGTACATTAATCTAGG + Intronic
1086384992 11:86298000-86298022 TTGAATCTGTAGATCAATTTGGG + Intergenic
1086430805 11:86734433-86734455 TTGACTCTGTAGATCAATTTGGG - Intergenic
1086780876 11:90904310-90904332 TTGAATCTGTAGATCAATTTGGG - Intergenic
1086794853 11:91087410-91087432 CTGAGTCTGTAGATCACTTTGGG + Intergenic
1087156070 11:94905449-94905471 TTGAATCTGTAAATAAATTTGGG - Intergenic
1087465912 11:98505171-98505193 TTGAATCAGTAGATCACTTTGGG + Intergenic
1087480078 11:98688543-98688565 TTGAATCTGTACATTAATTTAGG + Intergenic
1087607021 11:100389362-100389384 TTGAATCTGTACATTACTTTGGG - Intergenic
1087906029 11:103698814-103698836 TTGAATCTGTACATTGATTTGGG + Intergenic
1088218595 11:107542175-107542197 TTGAGTTTTTCCATCAATTTTGG - Intronic
1088398506 11:109396137-109396159 GTGAATCAGTAAATCATTTTGGG - Intergenic
1088948843 11:114544158-114544180 TTGAATCAATAAATCAAGTTGGG - Intronic
1088960624 11:114661175-114661197 TTGAATCTATAGATCAATTTTGG - Intergenic
1089277483 11:117347769-117347791 TTGACTCTGTAAATCAATTTGGG + Intronic
1089839490 11:121402586-121402608 TTGAATCTGTAGATCAATTAGGG + Intergenic
1089887045 11:121836830-121836852 TTGAATCTGTAGATCACTTTGGG - Intergenic
1090112762 11:123933275-123933297 TTGAATCCATAGATCAATTTAGG + Intergenic
1090552225 11:127834105-127834127 TTGACTCTATAGATCAATTTAGG - Intergenic
1091342933 11:134833461-134833483 TTGAATCTGTAGATCACTTTGGG - Intergenic
1091438353 12:492539-492561 TTGAGTCTGTAGATCAAGTTGGG - Intronic
1091594031 12:1863488-1863510 TTGAATCTATAAATCAATTTGGG + Intronic
1092516064 12:9214399-9214421 TTGAATCTGTACATCAATTTGGG + Intergenic
1093737130 12:22633615-22633637 TGGAATCAGTAGATAAATTTGGG + Intronic
1093975644 12:25418822-25418844 TTGAATTTGTAGATCAATTTGGG + Intronic
1094165946 12:27443896-27443918 TTGAATCTGTAAATTAATTTGGG - Intergenic
1094308282 12:29047061-29047083 TTGAATCTATACATCAGTTTAGG - Intergenic
1094388570 12:29922373-29922395 TTGAATCTGTAGATCACTTTGGG - Intergenic
1094391464 12:29955464-29955486 TTGAATCTGTACATTAATTTTGG - Intergenic
1094398552 12:30035685-30035707 TTGAATCTGAATATCAATTTGGG - Intergenic
1095235735 12:39793395-39793417 TTGACTCTATAGATCAATTTGGG - Intronic
1095375566 12:41524282-41524304 TTGAATCTGTAGATCACTTTTGG - Intronic
1095565365 12:43616971-43616993 TTGATTCTGTAGATAAATTTGGG + Intergenic
1095634282 12:44414136-44414158 TTGAGTCTGTATATCAAGTTGGG - Intergenic
1095835540 12:46634540-46634562 TTGAATCTGTAGATCAAGTTGGG + Intergenic
1096435545 12:51588197-51588219 TTGAATCTGTAGATCAACTTGGG - Intergenic
1096568567 12:52502683-52502705 TTGAATCTGTAGATCAAGTTGGG + Intergenic
1096605445 12:52761926-52761948 TTCAGTCAGTCCCTCCATTTGGG + Intergenic
1097132875 12:56826207-56826229 TTGACTCCGTAGATCACTTTTGG + Intergenic
1097465430 12:59918301-59918323 TTGAGTCTGTTAATCAATATTGG + Intergenic
1097708140 12:62889193-62889215 TTGAGTATGTAGATCAAGTTGGG - Intronic
1098164958 12:67686099-67686121 TTGGGTCTGTAGATCAATTCAGG + Intergenic
1098526868 12:71496698-71496720 TTGAGTGGGTACATAAATTGTGG + Intronic
1098644023 12:72875604-72875626 TTGAATCTGTAGATCACTTTGGG + Intergenic
1098689813 12:73472822-73472844 TTCAGACAGAGCATCAATTTGGG + Intergenic
1098787578 12:74779585-74779607 TTGACTCTGAACTTCAATTTGGG - Intergenic
1098983024 12:76979468-76979490 TTGAATCTGTAGATCAGTTTGGG + Intergenic
1099430810 12:82583389-82583411 TTGAATCTGTATATCACTTTGGG - Intergenic
1099950643 12:89298686-89298708 TTGAGTCTGTACATCATTTTGGG - Intergenic
1099966300 12:89449367-89449389 GTGTTTCAGTAAATCAATTTAGG - Intronic
1100084275 12:90889021-90889043 TTGAATCTGTAGATCTATTTGGG + Intergenic
1100160255 12:91851369-91851391 TTGAATTTGTAGATCAATTTGGG - Intergenic
1100298376 12:93284207-93284229 TTGAATCTATAGATCAATTTAGG - Intergenic
1100729770 12:97451847-97451869 TTGAATCTGTAAATCACTTTGGG + Intergenic
1100872802 12:98929351-98929373 TTGAATCTGTAGATCAATTTGGG - Intronic
1101103669 12:101419807-101419829 TTGAATCTGTAGATTAATTTGGG + Intergenic
1101944999 12:109129963-109129985 TTGAGTGACTACATGAATCTTGG + Intronic
1102319833 12:111923009-111923031 TTGAATCTGTAGATCAAGTTGGG - Intergenic
1102408661 12:112697539-112697561 TTAAGCCTGTAAATCAATTTGGG - Intronic
1102851927 12:116254970-116254992 TTGAATCTGTAGATCAAATTGGG - Intronic
1103055069 12:117812726-117812748 TTGAATCTGTAGATCACTTTGGG - Intronic
1103508596 12:121458051-121458073 TTGAGTCTGTTGATCACTTTGGG - Intronic
1104072563 12:125358579-125358601 TTGAGAAAGTTCCTCAATTTGGG + Intronic
1104147701 12:126051502-126051524 TTGAGTCACTAAACCAATTATGG - Intergenic
1104495693 12:129235914-129235936 TTGAATCTGTAGATCACTTTGGG + Intronic
1104619000 12:130295829-130295851 TTGAAGCTGTAGATCAATTTGGG - Intergenic
1105463368 13:20612561-20612583 CTGAATCTGTACATTAATTTGGG - Intronic
1105515173 13:21083223-21083245 TTGAATCTGTAGATCAATTTTGG - Intergenic
1105763624 13:23536219-23536241 TTAAATCTGTAGATCAATTTCGG + Intergenic
1105937021 13:25110822-25110844 TTAAATCTGTAGATCAATTTGGG + Intergenic
1106045853 13:26141051-26141073 TTGAATCTGTAGATCAATTTGGG - Intronic
1106262658 13:28081193-28081215 CTGAATCACTAGATCAATTTGGG + Intronic
1106299072 13:28446723-28446745 TTTAATCTGTAGATCAATTTGGG - Intronic
1106365829 13:29079962-29079984 TTGAATCGGTAGATCAATTTGGG + Intronic
1106732758 13:32558976-32558998 TTAAATCTGTAAATCAATTTGGG + Intergenic
1106779593 13:33044387-33044409 TTGATTCAGTAGGTCAATCTGGG + Intronic
1107067891 13:36236075-36236097 TTGAATCTGTAGATCACTTTGGG - Intronic
1107135078 13:36935327-36935349 TTAAGCCTGTACATCAATTTTGG + Intergenic
1107361980 13:39628336-39628358 TTGAATCTGTAGATCACTTTGGG + Intergenic
1107767542 13:43753235-43753257 TTGAATCTATAGATCAATTTGGG + Intronic
1108019959 13:46117832-46117854 TTGAGTCTATAGATCAATGTGGG - Intergenic
1108132230 13:47314378-47314400 TTGATGCTGTAGATCAATTTGGG - Intergenic
1108368490 13:49742673-49742695 CTGAATCTGTACATCACTTTGGG + Intronic
1108589440 13:51899573-51899595 TTGAATCTGTTCATCAATTTGGG - Intergenic
1108796642 13:54039601-54039623 TTGAATCTGTATATCACTTTGGG - Intergenic
1108868499 13:54951565-54951587 TTTAATCTCTACATCAATTTAGG - Intergenic
1109146507 13:58786454-58786476 TTGAGTCGATAAATCACTTTGGG + Intergenic
1109212306 13:59548383-59548405 TTAAGGCACTGCATCAATTTAGG - Intergenic
1109335497 13:60989158-60989180 TTGAATCTGTAAATCACTTTGGG + Intergenic
1109427805 13:62190331-62190353 TTGAATCTGTAGATCACTTTGGG - Intergenic
1109498311 13:63204473-63204495 TTCAATCTGTACATCAAATTTGG - Intergenic
1109889987 13:68598945-68598967 TTGATTCAGTATAAGAATTTAGG + Intergenic
1109901821 13:68782811-68782833 TTGAATCTATACATCAAATTGGG + Intergenic
1110089082 13:71422465-71422487 TTGAATCTGTATATCACTTTGGG + Intergenic
1110314530 13:74090446-74090468 TTGAATCTGTAGATTAATTTGGG - Intronic
1110400572 13:75086246-75086268 TTGAATCTGTAGATCAATCTGGG - Intergenic
1111294564 13:86262147-86262169 TTGAATCTGTAGATCAATGTGGG + Intergenic
1111298173 13:86310824-86310846 GTGAGTTAATACATTAATTTTGG - Intergenic
1111326168 13:86699098-86699120 TTGAGCCTGTAGATCAATTTGGG - Intergenic
1111341129 13:86887859-86887881 TTGAATCTATAGATCAATTTGGG - Intergenic
1111481872 13:88839902-88839924 TTGACTCTATATATCAATTTGGG - Intergenic
1111608254 13:90568708-90568730 TTAAATCTGTAAATCAATTTGGG + Intergenic
1111831286 13:93333262-93333284 TTGAATCTGTAGATCACTTTGGG + Intronic
1111891945 13:94093668-94093690 TTGAATCTGTAGATCACTTTGGG + Intronic
1112058471 13:95713558-95713580 TTGAATCTGTAGACCAATTTGGG - Intronic
1112562884 13:100529454-100529476 TTAAGTCAGAACACAAATTTCGG + Intronic
1112592526 13:100776736-100776758 ATGAGCCAGTTCATCAATCTGGG - Intergenic
1112793113 13:103025451-103025473 TTGAATCTGTAGATCACTTTGGG + Intergenic
1113733880 13:112662939-112662961 TTGAATCTGTATATCACTTTGGG + Intronic
1113761237 13:112848151-112848173 TTTAATCAGTAGATCACTTTGGG + Intronic
1114205328 14:20565875-20565897 TTGAATCTGTAGATCACTTTGGG - Intergenic
1114276291 14:21148371-21148393 TTGAATCTGTAGATCAATTTGGG - Intergenic
1114520756 14:23333700-23333722 CTGAATCTGTAGATCAATTTAGG + Intergenic
1114687053 14:24543182-24543204 TTCAGTCAGTCCCTCCATTTGGG - Intergenic
1114989475 14:28269591-28269613 TTGAATCTGTAAATTAATTTGGG - Intergenic
1114991081 14:28290843-28290865 TTGAATCTGTAAATTAATTTGGG + Intergenic
1115033093 14:28821971-28821993 TTGAATCTGTAGATCACTTTGGG - Intergenic
1115045429 14:28986699-28986721 TTGAATCTGTAGATCACTTTGGG - Intergenic
1115270102 14:31541907-31541929 TTGAGTCAGTACATCAAACCAGG + Intronic
1115325855 14:32137633-32137655 TTGAATCTGTAGATCAATTTGGG + Intronic
1115363381 14:32529042-32529064 TTGAGGCTGTACATCAAGTTGGG + Intronic
1115393952 14:32885960-32885982 TTGAATCTGTAGATTAATTTGGG + Intergenic
1115686542 14:35802596-35802618 TTGAATCTATAGATCAATTTGGG - Intronic
1115937586 14:38571706-38571728 TTGAAGCTGTAGATCAATTTGGG - Intergenic
1116003822 14:39271591-39271613 TTGAGTCTGTTGATCAGTTTAGG + Intronic
1116015930 14:39407336-39407358 GTGAGTCTGTTGATCAATTTGGG - Intronic
1116258443 14:42588291-42588313 TTGAGTAACTTCATCAATTTTGG + Intergenic
1116270811 14:42763373-42763395 TTGAGTCAGGAAATCAATTTGGG + Intergenic
1116688312 14:48071899-48071921 TTGAGTCAGATGATCATTTTAGG + Intergenic
1117018020 14:51538928-51538950 TTGAATCTGTAGATCAATTTGGG + Intronic
1117068821 14:52037714-52037736 TTGAATTAATAGATCAATTTGGG + Intronic
1117124350 14:52605123-52605145 TTGAATCTGTAGATCACTTTGGG + Intronic
1117248635 14:53912968-53912990 TTGACTCTGCACGTCAATTTGGG + Intergenic
1117306785 14:54485591-54485613 TTGAATCTGTAGATCACTTTGGG - Intronic
1117589584 14:57253462-57253484 TTGAATCTGTAGATCACTTTGGG - Intronic
1117961300 14:61165268-61165290 TTGAGTCTATACATTAATTTGGG + Intergenic
1118037197 14:61880533-61880555 TTGAGTCTCTAGATCAATTTTGG + Intergenic
1118163082 14:63310578-63310600 TTGATTCAGTCCATAAATGTTGG - Intergenic
1118452302 14:65914441-65914463 TTGAATCTGTAGATCAATTTAGG - Intergenic
1119339715 14:73866559-73866581 TTGAGTCTGTAGATCAATTTGGG + Intronic
1119822394 14:77628720-77628742 CTGAATCTGTAGATCAATTTGGG - Intergenic
1120097684 14:80407372-80407394 TTGAATCTGTAGATCGATTTTGG - Intergenic
1120562729 14:86017012-86017034 TTGAATCTGTAGATCAGTTTGGG + Intergenic
1120687295 14:87552829-87552851 TTGAATCTGTAGATCACTTTGGG - Intergenic
1121167549 14:91821051-91821073 TTGAATCTGTAGATCAATTTGGG - Intronic
1121316851 14:92966518-92966540 TTGAGTCTATAGATCAATTTGGG - Intronic
1121609454 14:95266617-95266639 CTGAGTCTGTAAATCACTTTGGG - Intronic
1121808784 14:96858958-96858980 TTGACTCTGTAGACCAATTTGGG + Intronic
1122385813 14:101346748-101346770 TTGAATCTGTACACTAATTTGGG - Intergenic
1122618771 14:103040849-103040871 TTGAATCTGTAGGTCAATTTGGG - Intronic
1122755732 14:103978236-103978258 ATGAATCTGTACATCACTTTGGG + Intronic
1123015619 14:105373153-105373175 TTGAATTTGTACATCAATTTAGG - Intronic
1123453463 15:20390735-20390757 TTGAATCTATAGATCAATTTTGG + Intergenic
1123726216 15:23104547-23104569 TTGAGTCTATAGATCAATTTGGG + Intergenic
1124020749 15:25920586-25920608 TTGAATCTGTAGATCACTTTGGG + Intergenic
1124194847 15:27615231-27615253 TTGAGTCAGTAGGTTAAGTTGGG - Intergenic
1124393402 15:29279690-29279712 TTGAGTCTGCAGATCAATTTGGG + Intronic
1124418630 15:29495974-29495996 TTGAATCTGTAGATCACTTTGGG + Intronic
1124682363 15:31745120-31745142 TTGAATCTGTAGATTAATTTTGG - Intronic
1124699514 15:31900667-31900689 TTGAATCTGTAGATCAGTTTGGG - Intergenic
1124713746 15:32037481-32037503 TTGAATCTGTAGATCAAGTTGGG + Intronic
1124844465 15:33276964-33276986 TTGAATCTGTAGATCATTTTGGG + Intergenic
1124878616 15:33620457-33620479 TTGACTCAGCACTTCACTTTAGG + Intronic
1126480691 15:49116630-49116652 GTGAGTCAGTACAGCCATTATGG + Intronic
1126896731 15:53265495-53265517 TGGAGGAAGTACATCATTTTGGG - Intergenic
1126991435 15:54381520-54381542 TTGACTCTGTAGATCACTTTGGG + Intronic
1127063375 15:55211321-55211343 TTGAGTCAGTAAATTGCTTTGGG + Intronic
1127345905 15:58097991-58098013 TTGAATCTGTAGATCAATTCAGG + Intronic
1127731271 15:61804239-61804261 TTGAATCTGTAGATCAGTTTGGG - Intergenic
1128010037 15:64284383-64284405 TTGAATCTGTACTTCAACTTGGG + Intronic
1128102338 15:65012919-65012941 TTGAATCTGTACATCAACTTGGG + Intronic
1128421719 15:67497932-67497954 TTGAATCTATAGATCAATTTGGG - Intronic
1128663317 15:69519218-69519240 TTGAATCTGTAGATCACTTTTGG - Intergenic
1128899342 15:71405711-71405733 TTGAATCTGTAGATCAATATGGG + Intronic
1128917886 15:71582074-71582096 TTGACTCTGTAGATCACTTTTGG + Intronic
1129620629 15:77141458-77141480 TTAAATCTGTAGATCAATTTTGG - Intronic
1129896273 15:79108977-79108999 TTAAGTCTGCATATCAATTTGGG - Intergenic
1130757482 15:86780550-86780572 TTGAGTCAGTAGATCAATTTGGG + Intronic
1130784069 15:87076151-87076173 TTGAATTTGTAGATCAATTTAGG + Intergenic
1130998236 15:88917166-88917188 TTGAGTCTGTACATCAATTTGGG - Intergenic
1132108210 15:99080939-99080961 TTGATTCTATAGATCAATTTTGG - Intergenic
1132122283 15:99186873-99186895 TTGAATCTGTATCTCAATTTGGG - Intronic
1132137348 15:99354544-99354566 TTGATTCAGAACACGAATTTTGG + Intronic
1132168851 15:99626710-99626732 TTCAGTCTGTACATGAATTTGGG + Intronic
1132614658 16:834428-834450 TTGAATCTGTAGATCAATTTGGG - Intergenic
1133182059 16:4064312-4064334 TTGAATCTGTTGATCAATTTGGG - Intronic
1133408377 16:5546241-5546263 TTGACTCTGTAGATCAATTTGGG - Intergenic
1133994052 16:10733772-10733794 TTAAGTCTGTCCATCAATTTAGG - Intergenic
1134177320 16:12018126-12018148 TTAAGTTTGTACATTAATTTGGG + Intronic
1134437441 16:14274235-14274257 TTAAATCTGTAGATCAATTTGGG - Intergenic
1135124181 16:19793593-19793615 TTGAATCTGTAGATCAATGTGGG - Intronic
1135378603 16:21973252-21973274 CTGAGTCAGTAGGTCCATTTTGG + Intronic
1135466357 16:22689021-22689043 TTGAATCTATACATCAAGTTGGG + Intergenic
1135749696 16:25047380-25047402 TTGACTCCATAGATCAATTTGGG - Intergenic
1135902967 16:26483234-26483256 TTGAGTCTGTAGATTGATTTGGG - Intergenic
1135996076 16:27249828-27249850 TTGAATCTATAGATCAATTTGGG + Intronic
1136266518 16:29123449-29123471 TTGAGTCTGTAGATCAATTTGGG + Intergenic
1136658999 16:31737892-31737914 TTGAATCTGTAGATCACTTTAGG + Intronic
1136711933 16:32245435-32245457 TTGAATCTGTAGATCATTTTGGG + Intergenic
1136734185 16:32448387-32448409 TTGAATCTGTAGATCACTTTGGG + Intergenic
1136755983 16:32683971-32683993 TTGAATCTGTAGATCATTTTGGG - Intergenic
1136812130 16:33186401-33186423 TTGAATCTGTAGATCATTTTGGG + Intergenic
1136818606 16:33296481-33296503 TTGAATCTGTAGATCATTTTGGG + Intronic
1136825170 16:33353014-33353036 TTGAATCTGTAGATCATTTTGGG + Intergenic
1136830236 16:33451785-33451807 TTGAATCTGTAGATCATTTTGGG + Intergenic
1137015718 16:35372468-35372490 TTGAATCTGTAGATCACTTTGGG - Intergenic
1137239703 16:46645399-46645421 TTGAATCTATACATTAATTTGGG - Intergenic
1137749713 16:50850671-50850693 TTGAATCTGTAGATCAGTTTGGG + Intergenic
1137867770 16:51918549-51918571 TTGAGGCAGCATCTCAATTTGGG + Intergenic
1137981145 16:53071059-53071081 TTGACTCTGTAGATCACTTTGGG + Intronic
1138048107 16:53747276-53747298 GTGAATCAGTACAGCAATTATGG - Intronic
1138355678 16:56378018-56378040 TTGAATCTGTACATCAAGTTGGG - Intronic
1138557057 16:57777271-57777293 TTGAATCTGTAGATCACTTTGGG - Intronic
1138591903 16:58004669-58004691 TTGAATCTGTAGATCAAATTGGG + Intronic
1139263155 16:65614824-65614846 TTGAATCAGTAAATTGATTTAGG + Intergenic
1139343115 16:66284046-66284068 TTGAGTCTTTAAATCACTTTGGG - Intergenic
1139566126 16:67777695-67777717 TTGAATCTGTATATCACTTTGGG - Intronic
1139637743 16:68268478-68268500 TTTAGTCATTACAAAAATTTTGG + Intronic
1140138923 16:72235584-72235606 TTGAATCTGTAGATCACTTTGGG + Intergenic
1140180435 16:72711205-72711227 TTGAATCTGTACATCACTTTGGG + Intergenic
1140582338 16:76246421-76246443 TTGAGTCTATAAATCAATTTAGG - Intergenic
1140614215 16:76640634-76640656 TTGAATCTGTAGATCATTTTTGG + Intergenic
1141037222 16:80638406-80638428 TTGAGTCTATAGATCAAGTTGGG - Intronic
1141209930 16:81968879-81968901 TTGAATCTGTAGATCACTTTGGG + Intergenic
1141237859 16:82236196-82236218 TTGAATCTGTACATCAAGTAGGG - Intergenic
1142055373 16:87991463-87991485 TTGAATCTGTAGATCAATTTGGG + Intronic
1202990708 16_KI270728v1_random:9371-9393 TTGAATCTGTAGATCATTTTGGG + Intergenic
1203018892 16_KI270728v1_random:381212-381234 TTGAATCTGTAGATCACTTTGGG - Intergenic
1203037227 16_KI270728v1_random:654370-654392 TTGAATCTGTAGATCACTTTGGG - Intergenic
1203058123 16_KI270728v1_random:944324-944346 TTGAATCTGTAGATCATTTTGGG - Intergenic
1142472181 17:170632-170654 TTGCGAGAGAACATCAATTTTGG + Intronic
1142948543 17:3457405-3457427 TTGAGTCTGTAGATCACTTTGGG - Intronic
1144518079 17:15933360-15933382 TTGAATATGTAGATCAATTTCGG + Intergenic
1145107447 17:20130788-20130810 TTGAACCTGTAAATCAATTTGGG + Intronic
1146099153 17:29962249-29962271 TTGAATCTGTAGATCACTTTGGG + Intronic
1146215315 17:30974473-30974495 TTGAATCTGTAGATCACTTTGGG + Intronic
1146410026 17:32575133-32575155 GTGAAACAGTACATAAATTTGGG - Intronic
1146672661 17:34752484-34752506 TTAGGTCAATACATAAATTTGGG + Intergenic
1146754377 17:35414532-35414554 TTGAATCTGTAGATCACTTTGGG - Intronic
1147128459 17:38390493-38390515 TTGAGTCAGTACATCAATTTGGG + Intronic
1147460836 17:40567947-40567969 TTGAATCTGTAAATCAATTTAGG + Intergenic
1148181569 17:45609376-45609398 TTGAGTCTGTAGATCAATTTGGG - Intergenic
1148263575 17:46206175-46206197 TTGATTCTGTAGATCAATTTAGG - Intronic
1148267281 17:46236317-46236339 TTGAGTCTGTAGATCAATTTGGG + Intergenic
1149187674 17:54018784-54018806 TTGAATCTGTAGATCACTTTGGG - Intergenic
1149675319 17:58454900-58454922 TTAAATCTGTACATCACTTTGGG - Intronic
1149944563 17:60908485-60908507 TGGAGTGAGTACATCAGTTAAGG + Intronic
1149959815 17:61095937-61095959 TTGAATCTGTATATCAAATTTGG + Intronic
1149977048 17:61276608-61276630 TTGAATCTGTAGATCAATTTGGG - Intronic
1150312768 17:64142669-64142691 TTGAATCTGTAGATCAATTTGGG - Intergenic
1150513814 17:65785989-65786011 CTGAATCTGTATATCAATTTGGG + Intronic
1150529937 17:65966900-65966922 TTGAATCTGTAGATCAATTTGGG - Intronic
1151094559 17:71481223-71481245 TTCAGTAAGTAAATAAATTTTGG - Intergenic
1151948838 17:77336299-77336321 TTGAATCTGTAGATCAATTAAGG + Intronic
1152411732 17:80128014-80128036 TTGAGTCTGTACATCAACCTGGG + Intergenic
1203168847 17_GL000205v2_random:127304-127326 TTAAGTCTGTAGATCACTTTGGG - Intergenic
1152971606 18:167364-167386 TTGAATCTGTAGCTCAATTTGGG + Intronic
1153081302 18:1228748-1228770 TGGAATCTGTAGATCAATTTGGG + Intergenic
1153240373 18:3025993-3026015 TTGAAACAGTATATCATTTTTGG - Intergenic
1153506168 18:5801294-5801316 TTGAATCTGTAGATCAGTTTAGG + Intergenic
1153873855 18:9347403-9347425 TTGAATCTGTAGATCAATTTGGG + Intronic
1154002688 18:10496496-10496518 TTGAATCTGTAGATCACTTTGGG - Intergenic
1154976889 18:21466678-21466700 TTGAATCTGTACACCAATTTGGG - Intronic
1155106329 18:22669759-22669781 CTGAGTCACTAAAACAATTTAGG + Intergenic
1155513602 18:26601582-26601604 TTGAATCTGCAGATCAATTTGGG + Intronic
1155564330 18:27116603-27116625 TTGACTCAGCTTATCAATTTTGG + Intronic
1155706241 18:28817530-28817552 ATGATTCAGTAAAACAATTTAGG - Intergenic
1155706403 18:28820169-28820191 TTGAGTCTGTAAATCTTTTTGGG + Intergenic
1155871396 18:31033209-31033231 TTGAATCTGTAAATTAATTTGGG - Intronic
1156024960 18:32642185-32642207 ATAAATCAGTACATCAATTTGGG + Intergenic
1156050463 18:32927287-32927309 TTGAATCTATACATCAGTTTTGG - Intergenic
1156052013 18:32948265-32948287 TTGAATCTTTAGATCAATTTGGG + Intronic
1156059712 18:33059223-33059245 TGGAGGCAGAACATCTATTTAGG + Intronic
1156244733 18:35287239-35287261 TTGAATCTGTAGATCAATATGGG - Intronic
1156335096 18:36163976-36163998 TTGATTCTCTAGATCAATTTGGG + Intronic
1156338831 18:36192524-36192546 TTGAATCTGTATATTAATTTGGG - Intronic
1156710072 18:39932874-39932896 TTGAGTCTATAGATCACTTTAGG - Intergenic
1157038259 18:44004323-44004345 TTGAATCTGTAGATCACTTTGGG - Intergenic
1157398187 18:47361372-47361394 TTGAATCTGTAGATCACTTTGGG + Intergenic
1157538298 18:48478010-48478032 TTGAATCTGTATATCACTTTTGG - Intergenic
1157572768 18:48723900-48723922 TTGAGTCCCTGCATCACTTTTGG - Intronic
1157961840 18:52162981-52163003 TTGAATCTATAGATCAATTTGGG + Intergenic
1158032870 18:52987994-52988016 TTAAGTCAGTAAAGGAATTTAGG + Intronic
1158431799 18:57395338-57395360 TTGAATCTGTAGATCACTTTGGG - Intergenic
1158486713 18:57873759-57873781 TTGAATCTGTAGATCAATTTAGG - Intergenic
1158743043 18:60165576-60165598 ATGAGCCAGTTTATCAATTTAGG - Intergenic
1158783613 18:60681820-60681842 TTGAATCTGTAGATCAAATTAGG - Intergenic
1158843567 18:61416008-61416030 TTGTGTTAGTACATCATCTTAGG - Intronic
1158928359 18:62295179-62295201 TTGACTCTGTAAATTAATTTGGG + Intronic
1159310072 18:66696612-66696634 TTAAATCTGTACATCAATATGGG - Intergenic
1159422471 18:68240810-68240832 TTGAATCTGTAGATCACTTTGGG - Intergenic
1159578849 18:70211947-70211969 TTGAATCTGTAGTTCAATTTTGG - Intergenic
1159579831 18:70222652-70222674 TTGAATCTGCAGATCAATTTGGG - Intergenic
1159588488 18:70305625-70305647 TTGAATCTATAGATCAATTTTGG + Intronic
1159855037 18:73576370-73576392 TTGAATCTGTAGATCACTTTGGG + Intergenic
1160576847 18:79860342-79860364 TTGACTCTGTTGATCAATTTAGG + Intergenic
1160627561 18:80222422-80222444 TTGAATCTGTAGATCAATTTGGG - Intronic
1163811265 19:19433503-19433525 TTGAATCTGTAGATCAGTTTGGG + Intronic
1164887298 19:31791870-31791892 TTGAATCAATAGATCAATTTGGG - Intergenic
1164962747 19:32449346-32449368 TTGAATCTGTAGATCAATTTGGG - Intronic
1165260217 19:34608031-34608053 TTGAATCTGTAGATCACTTTGGG + Intronic
1165292404 19:34898073-34898095 TTGAATCTGTAGATCAGTTTGGG - Intergenic
1165876516 19:39011464-39011486 CTGAATCTGTAGATCAATTTAGG + Intronic
1166910509 19:46151938-46151960 TTGATTCTATAGATCAATTTGGG + Intronic
1167398393 19:49247093-49247115 TTGAATCTGTAGATCAATTTGGG + Intergenic
1167400367 19:49263507-49263529 CTGAATCTGTAGATCAATTTGGG - Intergenic
1168449537 19:56454253-56454275 TTGAATCTGTAGATTAATTTGGG - Intronic
925043987 2:757050-757072 TTGAATCTGTAGATCACTTTTGG - Intergenic
925068149 2:945599-945621 CTGAGTCTGTAGATCACTTTGGG + Intergenic
925145172 2:1577817-1577839 TTGAATCTATAAATCAATTTCGG - Intergenic
925249127 2:2415394-2415416 CTGAATCGGTACATCAATTTGGG - Intergenic
925441055 2:3885873-3885895 TGGAGACAGTATAGCAATTTTGG + Intergenic
925534086 2:4897878-4897900 TTGAATCTGTAGATCGATTTGGG - Intergenic
925536245 2:4920500-4920522 TTGGGTTTGTACTTCAATTTTGG - Intergenic
925655272 2:6140903-6140925 TAGAATAAGTACATAAATTTGGG - Intergenic
926059608 2:9796982-9797004 TTGAATCTCTACATCAATTTGGG - Intergenic
926426354 2:12742012-12742034 TTAAGCCAGTACTTCAATTACGG + Exonic
926481626 2:13404909-13404931 TTGAATCTGTAAATCACTTTGGG - Intergenic
926481829 2:13408489-13408511 TTGAATCTATAGATCAATTTTGG - Intergenic
926640178 2:15227423-15227445 TTGAATCTGTAAATCACTTTGGG - Intronic
927237757 2:20890791-20890813 TTGCATCTGTAGATCAATTTGGG + Intergenic
927360374 2:22225250-22225272 TTGAGTCTGCAGATTAATTTGGG + Intergenic
927573989 2:24185531-24185553 TTGAATCTGTAGATCAATTTGGG + Intronic
927747616 2:25635580-25635602 TTGAATCTGTAAATCAAGTTGGG - Intronic
927816921 2:26226249-26226271 TTGAGTCAGTATATAAATTTGGG - Intronic
928160273 2:28917402-28917424 TTGAATCTGTAGGTCAATTTGGG - Intronic
928271807 2:29862693-29862715 TTGAATCTGTAGATCACTTTGGG - Intronic
928483835 2:31709647-31709669 TTGAATCTATAAATCAATTTGGG + Intergenic
928643839 2:33329946-33329968 TTGAATCAATAGATCAATTTGGG + Intronic
928851164 2:35748909-35748931 TTGAATCTGTAGATCAATTTGGG - Intergenic
929301947 2:40314570-40314592 TTGAATCTCTAGATCAATTTGGG + Intronic
929845759 2:45524718-45524740 TTGAATGAGTAGATCAGTTTGGG - Intronic
930295671 2:49550108-49550130 TTGAGTCAGTAAAACGATGTGGG + Intergenic
930340142 2:50102452-50102474 TTGAATAAGTACATAAATATTGG - Intronic
930450424 2:51529363-51529385 TTGAATCAATAGATCAATTTAGG + Intergenic
930593760 2:53360393-53360415 TTGAATGTGTAGATCAATTTTGG + Intergenic
930893263 2:56415815-56415837 TTGACTCTGTAGATAAATTTGGG + Intergenic
930977720 2:57484341-57484363 TTGAATCTGTAGATCAAGTTGGG + Intergenic
931119225 2:59197970-59197992 TTGGGTCATTACATCAAACTTGG + Intergenic
931489656 2:62730987-62731009 TTGAGTCTATAGATCAAATTGGG + Intronic
931578598 2:63747842-63747864 TTGATTCTGTAGATCAAATTAGG + Intronic
931889284 2:66652796-66652818 GTGAATCTGTAGATCAATTTGGG - Intergenic
932088926 2:68787740-68787762 TTGAACCAAGACATCAATTTAGG + Intronic
932273826 2:70435544-70435566 CTGAGTTTGTAGATCAATTTGGG + Intergenic
932518788 2:72384935-72384957 TTGAGTTTGTAGATCACTTTGGG - Intronic
932636578 2:73394304-73394326 ATGAATCTGTAGATCAATTTGGG + Intronic
932843405 2:75107628-75107650 TTGAGTCAATAAAAAAATTTAGG + Intronic
932871207 2:75400357-75400379 TTGAATCTGTAGATCACTTTGGG - Intergenic
932896770 2:75647421-75647443 TTGAGTCAGAACTTCAAGTAGGG + Intronic
932946116 2:76233724-76233746 TTGAATCTGTACATCACTTTGGG + Intergenic
933068275 2:77826365-77826387 TTGAATCTGTACATTATTTTGGG + Intergenic
933421093 2:82045781-82045803 TTGAATCTGTAGATCATTTTGGG - Intergenic
933553041 2:83798580-83798602 TTGAATCTGTAGATCTATTTGGG + Intergenic
933583706 2:84156646-84156668 TTGAATCTGTGGATCAATTTAGG + Intergenic
933618053 2:84504925-84504947 TTGAATCTGTACATCAATTTGGG + Intergenic
933852205 2:86377631-86377653 TTGAATCTGTAGATCACTTTGGG + Intergenic
934311549 2:91871059-91871081 TTGAATCTGTAGATCACTTTGGG - Intergenic
934536118 2:95135158-95135180 TTGAATCTGTAGATCAATTTGGG + Intronic
934650261 2:96086657-96086679 TTAAGTTTGTAGATCAATTTGGG - Intergenic
934705971 2:96481019-96481041 GTGAATCTGTAGATCAATTTTGG + Intergenic
934959705 2:98660297-98660319 TTGAATCTGTAGATCACTTTGGG - Intronic
934982808 2:98860220-98860242 TTGATTCTGTAAATCAGTTTGGG - Intronic
935093559 2:99921055-99921077 TTGAATCTTTAGATCAATTTGGG - Intronic
935376661 2:102407094-102407116 TTGACTCAGTAGAGAAATTTAGG - Intergenic
935791935 2:106600831-106600853 TTGAGTCTGTAGATCAATTTGGG + Intergenic
935802837 2:106715690-106715712 TTGAGTCTGTAAATCGTTTTGGG - Intergenic
935873484 2:107478614-107478636 TTAAATCTGTAGATCAATTTGGG - Intergenic
935928021 2:108091264-108091286 TTGAATCTGTAGATCACTTTGGG + Intergenic
936736834 2:115455390-115455412 TTGAATCTATAAATCAATTTGGG - Intronic
937135858 2:119551815-119551837 TTGAATCTGTAGATCAATTTGGG + Intronic
937187207 2:120055385-120055407 CTGAATCTGTATATCAATTTGGG + Intronic
937518565 2:122684259-122684281 TTGAATCTGTAGATCACTTTGGG + Intergenic
937843342 2:126550160-126550182 TTGAGTCTATACATCAGGTTGGG - Intergenic
937863107 2:126728859-126728881 TTGAATCTGTACATCACTTTGGG - Intergenic
938078690 2:128357143-128357165 TTGAGTCTGTTGATCAATTTGGG + Intergenic
938113106 2:128582331-128582353 TTGAATCTGTAGATGAATTTGGG + Intergenic
938209208 2:129451992-129452014 TTGAAACTGTAGATCAATTTGGG - Intergenic
938398891 2:130971732-130971754 TTGAATCTGTAGATCAGTTTTGG + Intronic
938554326 2:132410533-132410555 TTGAATCTATAGATCAATTTTGG + Intergenic
938665958 2:133537366-133537388 TTGAGTTTGTAGATCAATCTGGG + Intronic
938815164 2:134895470-134895492 TTGGATCTGTAGATCAATTTGGG - Intronic
938818722 2:134931622-134931644 TTGAATCTGTAGATAAATTTGGG + Intronic
939110112 2:137996595-137996617 TTGAATCTATAAATCAATTTGGG - Intronic
939747922 2:146000854-146000876 CTGAATCTGTAGATCAATTTGGG - Intergenic
939916532 2:148050990-148051012 TTGAGTCTGTGGATCAGTTTGGG + Intronic
939921523 2:148120359-148120381 TTGAATATGTAAATCAATTTTGG + Intronic
940535476 2:154935740-154935762 GTGAGCCAATACATTAATTTTGG - Intergenic
940745536 2:157563540-157563562 TTGAATCTGTAGATTAATTTAGG - Intronic
940920484 2:159300189-159300211 TTGAATCTGTAGATCAACTTGGG + Intergenic
941242594 2:163058088-163058110 TTGAGTCTATAGATCAAGTTAGG + Intergenic
941561041 2:167044825-167044847 TCGAATCTGTACATCACTTTGGG - Intronic
941587028 2:167372898-167372920 CTGAGTCTGTGGATCAATTTGGG - Intergenic
941803380 2:169686367-169686389 TTGAATGTGTAGATCAATTTGGG + Intronic
941946529 2:171104479-171104501 TTGAATCTGTAGATCACTTTTGG - Intronic
941958045 2:171224625-171224647 TTGAATCTGTAGATCAACTTGGG - Intronic
942271427 2:174279493-174279515 TTGAATCTATAGATCAATTTGGG + Intergenic
942352582 2:175068129-175068151 TTGAATCTGTAGATCACTTTGGG - Intergenic
942493746 2:176517235-176517257 TTGAATCAATAGATCAATTTTGG + Intergenic
943055399 2:182971466-182971488 TTGAATCTGTAGATCACTTTGGG - Intronic
943513883 2:188861096-188861118 TTGAATCTGTATATCAGTTTGGG - Intergenic
943546755 2:189289905-189289927 TTGAATCTGTAGATCACTTTGGG - Intergenic
943572654 2:189591938-189591960 TTGAATCTGTAGATCACTTTGGG + Intergenic
943805146 2:192115011-192115033 TTGAATCTGTAGATCACTTTGGG - Intronic
943878034 2:193099509-193099531 TTGAATCTGTAGATCACTTTCGG + Intergenic
943896847 2:193374236-193374258 TTAAACTAGTACATCAATTTGGG + Intergenic
944073234 2:195696366-195696388 TTGAATCTGTAAATCAACTTGGG + Intronic
944188606 2:196977243-196977265 TAGAATCTGTAGATCAATTTGGG - Intronic
945021485 2:205576861-205576883 TTGAATCTGTAGATCAAGTTGGG + Intronic
945327836 2:208503348-208503370 TTGAATCTATAGATCAATTTTGG + Intronic
945427583 2:209725569-209725591 TTGTGTGTGTACTTCAATTTGGG + Intronic
945759434 2:213895343-213895365 TTGAATCTGTAGATCACTTTGGG - Intronic
945823393 2:214691556-214691578 TTGAATCTGTAAATCAATTTGGG - Intergenic
945880854 2:215323372-215323394 TTGAATCTGTAGATCAATTTGGG + Intronic
946565633 2:220961670-220961692 GTGAATCAGTACAACTATTTTGG + Intergenic
946586526 2:221194736-221194758 TTGAATCTGTACATCACTTTTGG - Intergenic
946663139 2:222021974-222021996 TTGAGTCTGTAGATTACTTTGGG - Intergenic
947060466 2:226158909-226158931 TTGAATCTGTACATCACTTTGGG - Intergenic
947684073 2:232065732-232065754 TTGAGTCTGTAGATCAATTTGGG + Intronic
947694567 2:232174001-232174023 CTGAGTCTGTAGATCAGTTTGGG + Intronic
947867720 2:233412173-233412195 TTAAATCTGTAGATCAATTTGGG + Intronic
948587931 2:239031977-239031999 TTGACTCTATACATCAATTTTGG + Intergenic
948626222 2:239269988-239270010 TTGTGTAAGGACATCATTTTGGG - Intronic
1170005209 20:11661130-11661152 TTGAATCTGTAAGTCAATTTGGG + Intergenic
1170228309 20:14016912-14016934 TTGAATCTGTAGATCATTTTGGG + Intronic
1170410910 20:16090390-16090412 TTGAATTTGTAGATCAATTTGGG - Intergenic
1170462799 20:16594263-16594285 TTGAATCTGTAGATCAGTTTGGG - Intergenic
1170689495 20:18600668-18600690 TTGAGTCTGTAGATGAAGTTGGG + Intronic
1170825264 20:19788837-19788859 ATGAGTCCGTAGATCACTTTGGG - Intergenic
1171049862 20:21847102-21847124 TTAAATGTGTACATCAATTTGGG - Intergenic
1171109643 20:22468585-22468607 TTGGGTGAGTACTTGAATTTCGG - Intergenic
1172078844 20:32322075-32322097 TTGAATCTGTAGATCAATTTGGG + Intronic
1172130903 20:32654416-32654438 TTGAATCTGAAGATCAATTTGGG - Intergenic
1172381018 20:34491918-34491940 TTGAGTCAGTACAGACTTTTTGG - Intronic
1172785115 20:37463675-37463697 TTGAATCTATAGATCAATTTGGG + Intergenic
1172813161 20:37665350-37665372 TTGAATCTGTAGATCCATTTGGG + Intergenic
1173395943 20:42679621-42679643 ATGTGTCAGTACATAAATATTGG - Intronic
1175316429 20:58051122-58051144 TTGAATCTGCATATCAATTTGGG - Intergenic
1175662611 20:60827748-60827770 TTGAATAAGTAGATCAAATTGGG + Intergenic
1175701870 20:61144828-61144850 TTGAATCTGTAGATCAGTTTTGG + Intergenic
1176402909 21:6331846-6331868 TTAAGTCTGTAGATCACTTTGGG + Intergenic
1176434248 21:6657258-6657280 TTAAGTCTGTAGATCACTTTGGG - Intergenic
1176458510 21:6984328-6984350 TTAAGTCTGTAGATCACTTTGGG - Intergenic
1176771769 21:13081037-13081059 TTCAGTCAGTCCCTCCATTTGGG + Intergenic
1176898278 21:14409028-14409050 TTGAGTCTGTAGATCGTTTTGGG + Intergenic
1177011699 21:15738358-15738380 TTGAATCTGTAGATCCATTTGGG + Intronic
1177115128 21:17075848-17075870 TTGAGTCAGCAAATCTATCTAGG + Intergenic
1177125498 21:17188406-17188428 TTGAATCTATAGATCAATTTGGG - Intergenic
1177260878 21:18727891-18727913 TTGAATCTGTAGATCACTTTGGG - Intergenic
1177597220 21:23260780-23260802 TTGAGTGTGTAGATCAGTTTGGG - Intergenic
1177746878 21:25226328-25226350 TTCACTCTGTAGATCAATTTGGG + Intergenic
1177799221 21:25811396-25811418 TTGAATCTATAGATCAATTTGGG - Intergenic
1178243765 21:30932615-30932637 TTGAATCTGTAGATCACTTTGGG - Intergenic
1178260301 21:31093656-31093678 TTGATTCTGTAGATCATTTTAGG + Intergenic
1178427353 21:32489665-32489687 TTGAGCCTGTAGATCACTTTGGG + Intronic
1179772730 21:43635256-43635278 TTGAATCTGTAGATCAGTTTGGG - Intronic
1180088540 21:45521441-45521463 TTAAGCCAGTGTATCAATTTTGG - Intronic
1180165806 21:46027582-46027604 TTGAATCTGTATATTAATTTTGG - Intergenic
1180939879 22:19653167-19653189 CTGAGTTTGTAGATCAATTTGGG - Intergenic
1181578620 22:23813699-23813721 TTAAATCTGTATATCAATTTGGG - Intronic
1181994604 22:26866429-26866451 TTGAATCTGTACATCACTTTGGG + Intergenic
1182054740 22:27342093-27342115 TTGAATCCATAGATCAATTTAGG + Intergenic
1182142289 22:27970971-27970993 TTGAATCTATAAATCAATTTGGG + Intergenic
1182274730 22:29180052-29180074 TTGAGTTTGTAGATTAATTTGGG - Intergenic
1182400491 22:30072779-30072801 TTGAATCTGTAGATCAATTTGGG - Intergenic
1183088162 22:35500473-35500495 TTGAATCTGTAGATCACTTTTGG - Intergenic
1183127539 22:35798949-35798971 CTGAGTTAATACATCAGTTTAGG - Intronic
1183443469 22:37837212-37837234 GTGTGTCAGTACATCCCTTTTGG + Intronic
1183766728 22:39884121-39884143 TTGAATCTGTAGATCAATTTGGG - Intronic
1183793383 22:40093413-40093435 TTTAGTTATTTCATCAATTTTGG - Intronic
1184447504 22:44558421-44558443 TTGAATCATTAGATAAATTTGGG - Intergenic
1184509250 22:44922891-44922913 TTGAATCTGTAGATCAATCTGGG - Intronic
1184700304 22:46166807-46166829 TTGAATCTGTAGATCATTTTGGG - Intronic
1184941783 22:47773071-47773093 TTGAATCTGTACATCAATTTAGG - Intergenic
1184983255 22:48110768-48110790 TTAAACCTGTACATCAATTTGGG - Intergenic
1185164149 22:49248627-49248649 TTGAATCTATAGATCAATTTAGG + Intergenic
949118043 3:352815-352837 TTGAGTCAGTTGATAAATATTGG + Intronic
949171482 3:1003894-1003916 TTGAGTCAATACATAAATTTAGG + Intergenic
949632982 3:5949412-5949434 TTGAGTCGATACATAAATTTGGG - Intergenic
949898314 3:8787744-8787766 TTAAATCTGTAGATCAATTTGGG + Intronic
950209128 3:11105285-11105307 TTGAATCTGTAGATCACTTTAGG + Intergenic
950696945 3:14708591-14708613 TTGATTCTGTAGATCACTTTGGG + Intronic
950735074 3:15000738-15000760 TTGAATCTTTAGATCAATTTGGG + Intronic
950828327 3:15849223-15849245 TTGAATCAATAGATCAATTTGGG - Intronic
950843517 3:15990769-15990791 TTGAATCTATAGATCAATTTGGG + Intergenic
951123294 3:18954278-18954300 TTGAATCTGTATATCAACTTGGG + Intergenic
951130740 3:19040562-19040584 CTGAATCTGTAAATCAATTTGGG - Intergenic
951223039 3:20089295-20089317 TTGAATCTGTAGATCACTTTGGG + Intronic
951376553 3:21925076-21925098 TTAAATCTGTATATCAATTTTGG - Intronic
951616631 3:24553997-24554019 TTGAATCTGCAGATCAATTTTGG + Intergenic
951719470 3:25682792-25682814 TTGAATTTGTAGATCAATTTGGG - Intergenic
951843977 3:27065643-27065665 TTGAGTTAGCACCTCAATTGTGG + Intergenic
952128135 3:30327149-30327171 TTGAATCTATACATCAAGTTGGG - Intergenic
953270638 3:41439792-41439814 TTGAGTTTACACATCAATTTTGG + Intronic
953313586 3:41904920-41904942 TTGAATGTGTAGATCAATTTAGG - Intronic
953539132 3:43799573-43799595 TTTAATCTGTACATCAATTCAGG - Intergenic
954102503 3:48386556-48386578 TTGAATCTGTAGATCATTTTGGG + Intronic
954515123 3:51167514-51167536 TTGAATCTGTAGATCACTTTTGG + Intronic
954522812 3:51244266-51244288 TTGAATCTGTAGATCACTTTGGG + Intronic
955174629 3:56601540-56601562 TTGAATCTGTACATTACTTTGGG + Intronic
955385977 3:58480430-58480452 TTGAATCTGTAGATCACTTTGGG + Intergenic
955517711 3:59744188-59744210 TTGAGGCAGAACATGATTTTTGG - Intergenic
955667107 3:61361922-61361944 TTGAATCTGTAGATCAATTTGGG - Intergenic
956282548 3:67573233-67573255 TTGATCCTGTACATCAATTGTGG - Intronic
956333140 3:68133434-68133456 TTGAATCTGTACATTACTTTGGG + Intronic
956465297 3:69514787-69514809 TTGAATCTGTAGATCATTTTGGG - Intronic
957180774 3:76874999-76875021 TTCATTCAACACATCAATTTTGG - Intronic
957360843 3:79155463-79155485 TTGAGTCACTAAATAATTTTAGG - Intronic
957375347 3:79349382-79349404 TTGAATCTGTAGATCAATTAGGG - Intronic
957462278 3:80536912-80536934 TTAAATCTGTATATCAATTTGGG - Intergenic
957629667 3:82702981-82703003 TTGAGTCTATACATTACTTTGGG + Intergenic
957688978 3:83542885-83542907 TTGAATCTGTAGATCACTTTGGG + Intergenic
958833620 3:99118305-99118327 TTGATTAAGTAAATCAAATTGGG - Intergenic
958846956 3:99276480-99276502 TTAAATCTGTAGATCAATTTGGG + Intergenic
958968081 3:100581212-100581234 ATGAGCCAGTATATCAATGTGGG + Intergenic
959229899 3:103634609-103634631 TTGAATCAGTATATCACTTTAGG - Intergenic
959272984 3:104237676-104237698 TTGAATCTGTAGATCACTTTAGG + Intergenic
959536954 3:107497470-107497492 TTGAGTCAGTCAATCTATTTTGG + Intergenic
959561330 3:107786241-107786263 TTGAATCTGTAGATCAATTTGGG - Intronic
959728822 3:109576791-109576813 TTGACTCTATAGATCAATTTGGG - Intergenic
960220557 3:115103274-115103296 TTGAATCTATAGATCAATTTGGG - Intronic
960328161 3:116322337-116322359 TTGAGTCATTACATGAAAATAGG + Intronic
960478153 3:118156928-118156950 TTGAATCTGTAGATGAATTTTGG - Intergenic
960849124 3:122034044-122034066 TTAAATCAATAGATCAATTTGGG + Intergenic
960860909 3:122152812-122152834 TTGAATCTGCAGATCAATTTGGG + Intergenic
961068206 3:123894520-123894542 TTGAATCTGTAGATCACTTTGGG + Intergenic
961341351 3:126223218-126223240 TTGAATCTGTAGATCACTTTGGG - Intergenic
961670948 3:128529654-128529676 TTGAATCTGTACATCAATTTGGG + Intergenic
962194322 3:133347202-133347224 TTGAATCTGTAGATCAAGTTGGG + Intronic
962288839 3:134112769-134112791 TTGAGTCTGTAGATCGCTTTGGG - Intronic
962353637 3:134674966-134674988 TTGAATCTGTAGATCAGTTTGGG - Intronic
962514096 3:136132680-136132702 TTAAATCCGTACATCGATTTGGG - Intronic
963191126 3:142474302-142474324 TTGAATCTGTAGATCACTTTGGG + Intronic
963276421 3:143335347-143335369 TTGAATCTATACATCATTTTGGG - Intronic
963377545 3:144488069-144488091 TTGAGTCTGTAGATCAAGTTGGG + Intergenic
963671955 3:148261981-148262003 ATAAGTAAGTACATGAATTTGGG + Intergenic
963846378 3:150162309-150162331 TTGAATCTGTAGGTCAATTTGGG + Intergenic
963859132 3:150289223-150289245 TTGAATCTGTAGATCAACTTGGG - Intergenic
964460814 3:156925003-156925025 TTGAATCTATAGATCAATTTGGG + Exonic
964583149 3:158262628-158262650 TTGAGTCTGTAGATCAGTTTGGG + Intronic
965081816 3:164042823-164042845 TTGAATATGTAGATCAATTTGGG - Intergenic
965108786 3:164393899-164393921 ATGAATCTGTAGATCAATTTGGG - Intergenic
965253754 3:166377457-166377479 TTGAATCAGTAAATTATTTTGGG + Intergenic
965631373 3:170736512-170736534 TTGAATCTGTACATCGTTTTGGG - Intronic
965966670 3:174499990-174500012 TTGAATATATACATCAATTTGGG + Intronic
966515734 3:180819429-180819451 TTGAGTCTGTACATTGCTTTGGG - Intronic
966653911 3:182331718-182331740 CTGAGTTACTCCATCAATTTAGG - Intergenic
966813819 3:183872467-183872489 TTGAGTAAGTTCATCTATTTTGG + Intronic
966844279 3:184115168-184115190 TTGAATCTGTAGATCAATTTGGG - Intergenic
966858250 3:184211315-184211337 TTTAGTCGTTACATCTATTTAGG + Intronic
966904465 3:184512040-184512062 TTGTGTTATTTCATCAATTTTGG - Intronic
967039853 3:185681508-185681530 TTGAATCTGTAGATCACTTTCGG - Intronic
967437330 3:189463399-189463421 TTGAATCTGTAGATCACTTTGGG - Intergenic
967607131 3:191460250-191460272 TTGAATCTGTAGATCAGTTTGGG - Intergenic
967653716 3:192019292-192019314 TTGATTCTGTAAATCAATTAGGG + Intergenic
968024882 3:195432751-195432773 TTTAGTTTGTAGATCAATTTGGG + Intronic
968559045 4:1267007-1267029 TTGAATCTGTAGATCACTTTGGG + Intergenic
968587233 4:1425614-1425636 TTGAATCTGTAGATCACTTTGGG + Intergenic
968732723 4:2277759-2277781 TTGAATCTGTAGATCGATTTGGG - Intronic
968792592 4:2677869-2677891 TTGAATCTGTAGATCACTTTGGG + Intronic
968840250 4:2998784-2998806 TTGAATCTATAGATCAATTTGGG - Intronic
968851321 4:3081152-3081174 TTGAATCTGTAGATCAACTTGGG + Intronic
969631297 4:8339739-8339761 TTGAATCTGTAGATCACTTTTGG + Intergenic
969942186 4:10744430-10744452 TTGAATCTGTAGATCAATTTTGG - Intergenic
970214126 4:13740983-13741005 TTGAGTCTGTAAATTACTTTGGG + Intergenic
970482563 4:16492070-16492092 TTGAATCTGTAGATCAAATTGGG - Intergenic
970648705 4:18153746-18153768 TTGAATCAGTAGATCACATTGGG - Intergenic
970738455 4:19202894-19202916 TTGAATCTCTACATCACTTTGGG - Intergenic
970753168 4:19390869-19390891 TTGAATCTGTACATCACTTTTGG - Intergenic
970900899 4:21159026-21159048 TTGACTCTGTAAATCAATTTGGG - Intronic
971071641 4:23100564-23100586 TTGAATCTGTTGATCAATTTGGG + Intergenic
971327643 4:25657142-25657164 TTGAGACAGTTGAGCAATTTGGG - Intronic
971397817 4:26246129-26246151 TTGAGTCTGTGGATCAATTTGGG + Intronic
971432844 4:26586528-26586550 TTGAATCTGTAGATCAATTTGGG + Intronic
971526004 4:27620038-27620060 TTGAATCTATAGATCAATTTGGG - Intergenic
971710786 4:30108880-30108902 TTTAATCCATACATCAATTTGGG + Intergenic
971815264 4:31478725-31478747 CTGAGTCTGTAAATCACTTTGGG + Intergenic
971953522 4:33385215-33385237 TTGAATCTGTAGATCACTTTGGG - Intergenic
971959150 4:33462670-33462692 GTGAATCAGTAGATCATTTTAGG + Intergenic
972069507 4:34997787-34997809 TTTAATCTGTAGATCAATTTGGG + Intergenic
972137625 4:35911704-35911726 TTAAGTCAGTTCTTCAATTTGGG - Intergenic
972235479 4:37128680-37128702 TTGAATCAATAGATCATTTTAGG - Intergenic
972466527 4:39362235-39362257 TTGAATCTGTAGGTCAATTTAGG - Intronic
972761440 4:42109192-42109214 TTGAATCTGTAAATCAATTCGGG + Intergenic
972763417 4:42129349-42129371 TTGAATCTGTAAATCACTTTGGG - Intronic
972997522 4:44899609-44899631 TTGAATCTGTAGATCAATTTGGG + Intergenic
973269420 4:48246349-48246371 TTGAATCTGTAGATCCATTTGGG - Intronic
974360918 4:60877957-60877979 TTGACTCAGCCAATCAATTTTGG - Intergenic
974411638 4:61548904-61548926 TTGAATCTGTACATTGATTTGGG + Intronic
974482741 4:62467560-62467582 CTGAGTCTGTAAATCACTTTGGG - Intergenic
974675748 4:65086549-65086571 TTTAATCTGTACATTAATTTGGG + Intergenic
974728535 4:65829893-65829915 ATGAGCCAGTACTTCAATGTGGG + Intergenic
974737629 4:65958570-65958592 TTGAGTCTGTAGATCGTTTTGGG - Intergenic
974852084 4:67416044-67416066 TTGAATCTGTAGATTAATTTTGG + Intergenic
975004993 4:69272909-69272931 CTGAGTCAGTAAATTACTTTGGG - Intergenic
975339251 4:73219180-73219202 TTCAGTCACTAGACCAATTTAGG + Intronic
975688436 4:76941732-76941754 TTGAATCTGTAGATCAATTTAGG + Intergenic
975778253 4:77812747-77812769 TTAAATCTGTACATCAATTTTGG - Intronic
975996024 4:80316652-80316674 TTGAATCTATAAATCAATTTGGG - Intronic
976073893 4:81274461-81274483 TTGACTCTGTAGATCACTTTGGG - Intergenic
976363566 4:84208170-84208192 TTGAATCAATACATTACTTTGGG - Intergenic
976712777 4:88090570-88090592 TTCTGTCACAACATCAATTTGGG - Exonic
977133853 4:93276500-93276522 TTGAATCTGTAGATCAATTTGGG + Intronic
977439946 4:97052644-97052666 TATATTCAGGACATCAATTTTGG + Intergenic
977694713 4:99952572-99952594 TTGAGTTATTAAACCAATTTTGG - Intergenic
977822501 4:101490630-101490652 TTGAATCTGTAGATCACTTTGGG + Intronic
977871633 4:102097290-102097312 TTGAATCTGTAGATAAATTTTGG - Intergenic
978437913 4:108705671-108705693 TTGAGTCTATAAATCAATTTTGG - Intergenic
978893713 4:113859576-113859598 TTGAATCTGTAGATCACTTTGGG + Intergenic
979025108 4:115560971-115560993 TTGAATCTATACATCAATGTGGG + Intergenic
979170689 4:117598186-117598208 TTGACTCAATACTTAAATTTTGG + Intergenic
979172360 4:117617536-117617558 TTGAATCTGTAGATCACTTTGGG - Intergenic
980263781 4:130489440-130489462 TTGACTCTGTAGATCACTTTGGG + Intergenic
980317227 4:131218000-131218022 TTGAGTCTGTAAATTACTTTGGG + Intergenic
980560634 4:134469228-134469250 TTCAGTCTATAGATCAATTTTGG - Intergenic
981083997 4:140664412-140664434 TTGAATCTGTAGATCAGTTTGGG - Intronic
981092866 4:140750712-140750734 TTGAGTCTGTAAATAAATTTGGG - Intronic
981635351 4:146871826-146871848 TTGAATCTGTCAATCAATTTAGG - Intronic
981669351 4:147269260-147269282 TTGAATCTGTAGATCACTTTGGG + Intergenic
981868143 4:149452267-149452289 TTGAATCTGTAGATCAATTTGGG - Intergenic
981921776 4:150093335-150093357 TTGAATCTGTAAATCACTTTGGG - Intronic
982134499 4:152260535-152260557 TTGAATCTATAGATCAATTTGGG - Intergenic
982250855 4:153405063-153405085 TTGAATCTGTAGATCAATTTGGG - Intronic
982326229 4:154131145-154131167 TTGAATCTGTAGATTAATTTGGG - Intergenic
982342624 4:154318773-154318795 TTGAATCTGTAGATCAGTTTGGG - Intronic
982386897 4:154816305-154816327 TTGAATCTGTAGATCAGTTTGGG + Intronic
982727763 4:158923320-158923342 TTGAATCTGTAGATCTATTTAGG + Intronic
982796014 4:159645076-159645098 TTGAATCTGTAGATCACTTTGGG + Intergenic
982816525 4:159892350-159892372 TTAAATCTGTATATCAATTTGGG + Intergenic
982867909 4:160541078-160541100 ATGAGCCAGTTCATCAATCTGGG + Intergenic
982939134 4:161526415-161526437 AACAGACAGTACATCAATTTAGG + Intronic
983031525 4:162808720-162808742 TTGAATCTGTAGATCACTTTGGG - Intergenic
983371563 4:166865854-166865876 TTGAATCTGTAAATCACTTTGGG - Intronic
983461723 4:168032639-168032661 TTGAATCTATAGATCAATTTAGG + Intergenic
983666085 4:170185578-170185600 TTGAATCTGTAAATCACTTTGGG + Intergenic
983705050 4:170647450-170647472 TTGAATCTGTAGATCATTTTTGG + Intergenic
984074310 4:175155494-175155516 CTGAATCTATACATCAATTTTGG + Intergenic
984245238 4:177267738-177267760 ATGAGCCAGTTTATCAATTTTGG + Intergenic
984319799 4:178179346-178179368 TTGAATCTGCAGATCAATTTGGG - Intergenic
984419593 4:179503227-179503249 TTGAATCTGTAGATCAGTTTGGG + Intergenic
984482540 4:180324400-180324422 TTGAATCTGTACATTACTTTGGG + Intergenic
984525742 4:180857433-180857455 TTGAGTCTGTAAATTACTTTGGG + Intergenic
984636632 4:182117856-182117878 TTGAATCTGTAGATCAAGTTGGG + Intergenic
985192118 4:187385937-187385959 TTGAATATGTACACCAATTTGGG - Intergenic
985298607 4:188462416-188462438 TTGAATCTGTAGATCATTTTGGG - Intergenic
985352344 4:189078419-189078441 TTGAATCTATAGATCAATTTTGG - Intergenic
985373688 4:189312674-189312696 TTGAATCTGTACATCAGTTTAGG - Intergenic
986183165 5:5412824-5412846 TTGAATCTGTAAATTAATTTGGG - Intergenic
986556887 5:9018941-9018963 TTGAATCTGTAAATCAATTTTGG - Intergenic
986754795 5:10825221-10825243 TTGACTCTGTAGATCATTTTAGG - Intergenic
986991709 5:13561316-13561338 TTGAATCCATATATCAATTTGGG - Intergenic
987044709 5:14096707-14096729 TTGAATCTGTGGATCAATTTGGG - Intergenic
987184539 5:15402165-15402187 TTGAATCTGTAGATCACTTTGGG - Intergenic
987715769 5:21567964-21567986 TTGACTCTGTAGATCACTTTTGG + Intergenic
988048796 5:25996489-25996511 TTCAGTCAATATATAAATTTAGG - Intergenic
988461980 5:31447400-31447422 TTGATTCTGTAGATCAATTTGGG - Intronic
988549564 5:32187656-32187678 TTGAATCTGTAGATCACTTTGGG - Intergenic
988583205 5:32486372-32486394 TTGAGTCTGTAGATCATTTTGGG + Intergenic
988624623 5:32860112-32860134 TTGAATCTGTAGATCACTTTGGG + Intergenic
988841210 5:35085827-35085849 TTGAAACATTACATCAATATTGG + Intronic
988876534 5:35453250-35453272 ATGAGTCAATATATGAATTTTGG + Intergenic
988935724 5:36080878-36080900 TTGAATCTAGACATCAATTTGGG + Intergenic
989052992 5:37339705-37339727 CTGAATCAGTATATCAATTTGGG - Intronic
989392905 5:40921381-40921403 TTGAATCTGTAGATCACTTTGGG - Intronic
989416829 5:41188204-41188226 TTGAATCTATAAATCAATTTGGG - Intronic
989420116 5:41228035-41228057 TTGAATCTGTAGATCGATTTTGG + Intronic
990125831 5:52517093-52517115 TTGAATCTGTAGATCATTTTTGG - Intergenic
990144853 5:52747913-52747935 TTGATTTTGTAGATCAATTTGGG - Intergenic
990153919 5:52852533-52852555 ATGAGCCAGTACAGAAATTTTGG - Intronic
990330067 5:54716616-54716638 TTGAATCTGTAGATCACTTTGGG - Intergenic
990351008 5:54916060-54916082 TTGAATCTGTAAGTCAATTTGGG + Intergenic
990379522 5:55208485-55208507 TTGACTCTGTAGATCAATGTAGG - Intergenic
991119146 5:62991077-62991099 TTGAATCTGTAGATCAAGTTGGG + Intergenic
991642848 5:68771723-68771745 TTGAGCCACTACAACAAATTGGG + Intergenic
991644122 5:68783893-68783915 TTGAATCTGTAGATCACTTTGGG - Intergenic
991723145 5:69512613-69512635 TTGAATCTGTAGGTCAATTTTGG + Intronic
991932924 5:71772479-71772501 TTGAATCTGTAGAACAATTTGGG + Intergenic
992011833 5:72535685-72535707 TTGAATCTATACATCAATTTGGG - Intergenic
992406751 5:76465950-76465972 TTGAATCTATAAATCAATTTGGG - Intronic
992468929 5:77035023-77035045 TTCAGTCAGGACATAATTTTTGG + Intronic
992485812 5:77193734-77193756 TTGAATCTATAGATCAATTTAGG + Intergenic
992601074 5:78400433-78400455 TTGAATCTGTAGATCAAGTTGGG + Intronic
992668796 5:79037997-79038019 TTGAATCTGTAGATCATTTTGGG - Intronic
992720187 5:79552995-79553017 TTGACCCAGTTCATCTATTTGGG - Intergenic
992802506 5:80306418-80306440 TTGAATCAGTGAATCAATTTAGG + Intergenic
992903098 5:81318613-81318635 TTGAGTCTGTAGATGAATTTGGG + Intergenic
993263096 5:85686596-85686618 TTCCGTCTGTAGATCAATTTAGG + Intergenic
993429948 5:87819916-87819938 TTGACTTTGTAAATCAATTTGGG + Intergenic
993668899 5:90735579-90735601 TTGAATCTGTAGATCACTTTGGG + Intronic
994189214 5:96849682-96849704 TTGAATCTGTAGATCATTTTGGG - Intronic
994264280 5:97696374-97696396 TTGAGTCAGCACAACAAATCCGG - Intergenic
994446689 5:99883653-99883675 TTAAATCTGTAGATCAATTTTGG + Intergenic
994738808 5:103593034-103593056 TTGAATTTGTACATCAAGTTGGG + Intergenic
994854179 5:105095914-105095936 TTGAGTCTGTAGATGACTTTGGG - Intergenic
995571095 5:113483335-113483357 TTGATTCTGTAAATCAATTTGGG + Intronic
995735015 5:115290553-115290575 CTGAATCTGTAAATCAATTTGGG + Intronic
996171670 5:120300287-120300309 TTGCATCAGTACTTCGATTTGGG - Intergenic
996433701 5:123410267-123410289 TTGAATCTGTAGATCAAATTAGG - Intronic
996451924 5:123635830-123635852 TTGAATCTGTAGATCATTTTGGG - Intergenic
996592897 5:125167779-125167801 TTGAATCTGTAGATCAAGTTGGG - Intergenic
996597151 5:125218347-125218369 TTAAGTCTGTAAATCACTTTGGG - Intergenic
996676097 5:126176413-126176435 TTGAATCTGTAAATCATTTTGGG - Intergenic
996803003 5:127424436-127424458 TTGAATCTATAGATCAATTTGGG + Intronic
997308229 5:132856440-132856462 TTGAATCTGTAGATCAGTTTTGG - Intergenic
997707383 5:135969665-135969687 TTGAATCTGTAGATCAATTTAGG + Intergenic
997890901 5:137675896-137675918 TTGAGACAGTTGGTCAATTTGGG - Intronic
998076677 5:139242123-139242145 TTGAAGCTGTAGATCAATTTGGG - Intronic
998356556 5:141541962-141541984 TTGAATCTGTAGATCGATTTGGG - Intronic
999315558 5:150581615-150581637 TTGAATCTGTAGATCAATTTTGG - Intergenic
999346374 5:150823758-150823780 TTGAATCTGTAGATCACTTTGGG - Intergenic
999505568 5:152192085-152192107 TTAAGTCTATAGATCAATTTGGG + Intergenic
1000590430 5:163151302-163151324 TTGAATCTGTAAATCACTTTGGG - Intergenic
1000620947 5:163486200-163486222 TTGAATCTGTAGATCAGTTTGGG + Intronic
1000645207 5:163753211-163753233 TTGAATCTGTAGATCACTTTGGG + Intergenic
1000737604 5:164924896-164924918 TTGAATCTGTAAATCACTTTGGG + Intergenic
1000859687 5:166441248-166441270 TTGAATCTGTAGATCAATTTGGG + Intergenic
1000868336 5:166542876-166542898 TTGAGTTTATACAGCAATTTGGG + Intergenic
1001248770 5:170128050-170128072 TTGAATCTGTAGTTCAATTTGGG - Intergenic
1001685135 5:173588594-173588616 TTGAATCAATAGATCAGTTTTGG - Intergenic
1001830371 5:174781873-174781895 TTGAGTCTGTAGGTCACTTTGGG + Intergenic
1002631709 5:180585845-180585867 TTGAATCTGTAGATCAATTTAGG - Intergenic
1002678747 5:180942365-180942387 TTGACTCTGTAGATCACTTTGGG - Intronic
1002767032 6:250301-250323 TTGAATCTGTAGATCAATTTGGG + Intergenic
1002902526 6:1421727-1421749 TTTAATCTGTACATCAATTTAGG + Intergenic
1003262853 6:4537859-4537881 TTGAATCTGCAGATCAATTTGGG - Intergenic
1003851569 6:10228713-10228735 TTGAGTCTATACATTACTTTGGG - Intergenic
1003903606 6:10678223-10678245 TTGATTCTGTAGATCACTTTGGG + Intronic
1003913046 6:10760076-10760098 ATGAGCCAGTTTATCAATTTGGG - Intronic
1004207138 6:13602165-13602187 TTGAGCCCATAGATCAATTTGGG - Intronic
1004587761 6:17019008-17019030 TTGACTCCGTAGATCACTTTGGG - Intergenic
1004737016 6:18417167-18417189 TTGAATCTGTAAATCCATTTGGG - Intronic
1004764167 6:18706041-18706063 TTGAATCTGTACATCATTTTGGG + Intergenic
1004792836 6:19046958-19046980 TTGAATCTATATATCAATTTGGG + Intergenic
1004911182 6:20286263-20286285 TTGAATCTGTACATCAATTTGGG - Intergenic
1005424460 6:25687254-25687276 TTGAATCTGCAGATCAATTTGGG + Intronic
1005996556 6:30934703-30934725 TTGAGGAAGGACATGAATTTGGG + Intergenic
1006482750 6:34311503-34311525 TTGAATCTGTAAATCAAGTTGGG - Intronic
1007190279 6:40009863-40009885 TTGAATCTGTAGATCGATTTGGG + Intergenic
1008341605 6:50371324-50371346 TTGAATCTGTAGATAAATTTAGG + Intergenic
1008648004 6:53534883-53534905 TTGAATCTGTAGATCAGTTTGGG - Intronic
1008863115 6:56175704-56175726 TTGAATCTGTAGATCAAGTTAGG - Intronic
1008967690 6:57330072-57330094 TTGAATCTGTAGATCAGTTTGGG + Intronic
1009000951 6:57714086-57714108 TTGACTCTGTAGATCACTTTTGG - Intergenic
1009057962 6:58361268-58361290 TTGAATCTGTAGATCACTTTGGG - Intergenic
1009694127 6:67075887-67075909 TTGACTTAGAAGATCAATTTGGG - Intergenic
1009789078 6:68377209-68377231 TTAAATTAGTACATCCATTTTGG - Intergenic
1009798032 6:68496958-68496980 TTGAGTCAACAGATTAATTTGGG - Intergenic
1010056058 6:71566233-71566255 TTGATTCTGTAAACCAATTTGGG - Intergenic
1010268433 6:73893008-73893030 TTGAATCTGTAGATCACTTTAGG + Intergenic
1010505771 6:76657065-76657087 TTGAATCTGTAGATCACTTTGGG - Intergenic
1010549996 6:77210139-77210161 TTGAGTCTGTAGATTACTTTGGG + Intergenic
1010623328 6:78103961-78103983 CTAAGTCAGTACACCACTTTTGG + Intergenic
1010626967 6:78149413-78149435 TTGAATCTGTAGATCACTTTGGG - Intergenic
1010748959 6:79596700-79596722 TTGAATCTGTAAATCAATTTGGG - Intergenic
1010857940 6:80866432-80866454 TTGAATCTGTAAGTCAATTTGGG - Intergenic
1010932938 6:81824508-81824530 TTGAATCTGTACATTATTTTGGG + Intergenic
1010961428 6:82150439-82150461 TTGAATCTGTACATTGATTTGGG - Intergenic
1011011513 6:82708779-82708801 TTGAATCTGTAGATCACTTTGGG + Intergenic
1011322032 6:86105954-86105976 GTGAGTCAGTAGATTGATTTAGG + Intergenic
1011437407 6:87353097-87353119 GTGAGGCAGTAAATGAATTTTGG + Intronic
1011577628 6:88820880-88820902 TTGAATCTGTAGATCAAATTGGG - Intronic
1011898859 6:92266889-92266911 TTGAATCTGTACATCACTTTGGG + Intergenic
1012132037 6:95508053-95508075 TTGAATCTGTAGATCACTTTGGG - Intergenic
1012462576 6:99480317-99480339 TTGAATGTGTAGATCAATTTGGG - Intronic
1012558413 6:100546287-100546309 TTAAATCTGTAGATCAATTTGGG - Intronic
1012705969 6:102530898-102530920 TTGAATCAGCAGATCACTTTGGG + Intergenic
1013340403 6:109209006-109209028 TTGAATCTGTGGATCAATTTGGG + Intergenic
1013760575 6:113512927-113512949 ATTGGTCAGTAAATCAATTTTGG + Intergenic
1014109543 6:117604794-117604816 TTGAGGTAGTATATCAATCTAGG + Intergenic
1014131089 6:117834557-117834579 TTGAATCTGTACATTACTTTGGG - Intergenic
1014133422 6:117861201-117861223 TTGAGTCTGTAAATTACTTTGGG - Intergenic
1014784645 6:125604461-125604483 TTGAATCTGTAGATCAAGTTGGG - Intergenic
1014926692 6:127279656-127279678 TTGAATCTGTAGATCACTTTGGG + Intronic
1014968278 6:127782812-127782834 TTGAGTCTATAAATCACTTTGGG - Intronic
1015032376 6:128610693-128610715 TTGAATCTGTAGATCACTTTGGG + Intergenic
1015058607 6:128934860-128934882 TTGACTCTGTAGATCATTTTGGG + Intronic
1015488881 6:133802275-133802297 TTGAGTCTGTACATAGCTTTGGG + Intergenic
1015558741 6:134491932-134491954 TTGAATCTTTAAATCAATTTAGG - Intergenic
1015668149 6:135654980-135655002 TTGAATCTGTAGATCAATGTGGG - Intergenic
1015800393 6:137055369-137055391 TTGAATCTGTAGATCAATTTGGG - Intergenic
1015925506 6:138306386-138306408 CTGAATCTATACATCAATTTGGG - Intronic
1015970299 6:138736799-138736821 TTAAGTCAGTACAACCACTTTGG + Intergenic
1016125178 6:140392609-140392631 TTGAATCTGTAGATCAGTTTGGG - Intergenic
1016401152 6:143682134-143682156 TTGAACCTGTAGATCAATTTGGG + Intronic
1016510511 6:144837610-144837632 TTGAGTCAATAAATCATTTCTGG - Intronic
1017031227 6:150224414-150224436 TTGCGTCTGTAGATCAAGTTGGG + Intronic
1017033244 6:150243097-150243119 TTAAATCTGTAGATCAATTTGGG - Intronic
1017097486 6:150817516-150817538 TTGAGTCAGTAGATCAGGGTTGG + Intronic
1017287496 6:152693086-152693108 TTGAGTCTTTAGATCACTTTGGG + Intergenic
1017749312 6:157475429-157475451 TTGAATCTGTAGATCACTTTAGG + Intronic
1018483025 6:164211217-164211239 TTGAGTCAGTAATACCATTTTGG + Intergenic
1018586332 6:165363940-165363962 TTGAATCTGTAAATCAATTTTGG - Intronic
1019396236 7:820140-820162 TTGAATCTGTACATCACTGTGGG + Intronic
1019600258 7:1879488-1879510 TTCAATCTGTAGATCAATTTGGG - Intronic
1019905800 7:4063531-4063553 TTGAGTCATTAGATTCATTTGGG - Intronic
1019945182 7:4322598-4322620 TTGCGTCTGTAGAGCAATTTGGG + Intergenic
1020971775 7:14952409-14952431 GTGATTCTGTAGATCAATTTGGG - Intronic
1021023850 7:15640049-15640071 TTGAATCTGTAGATCACTTTGGG + Intronic
1021515472 7:21479695-21479717 TTGAATCTGTAGATCACTTTGGG + Intronic
1021635953 7:22693332-22693354 TTGACTCTGTGCATCACTTTGGG - Intergenic
1022135679 7:27446107-27446129 TTGAATCTGCAGATCAATTTGGG + Intergenic
1023149365 7:37185891-37185913 TTGAATCTGTAGATCAATTTAGG - Intronic
1023273197 7:38488919-38488941 TTGAATCTGTAGATCACTTTGGG - Intronic
1023449265 7:40265367-40265389 TTGAAGCTGTAAATCAATTTGGG - Intronic
1023604400 7:41915656-41915678 TTGAGTCACTGAATCTATTTGGG + Intergenic
1023934725 7:44731355-44731377 TTGACTCTGTAGATCAATTTGGG - Intergenic
1023997279 7:45168006-45168028 TTGAGTTTGTATATCACTTTAGG + Intronic
1024144543 7:46499863-46499885 TTGAGTCAATAAATTACTTTGGG - Intergenic
1024299052 7:47872097-47872119 TCAAGTCTGTACATCAGTTTGGG - Intronic
1024591670 7:50891431-50891453 TTGAATCTGTAAATTAATTTGGG - Intergenic
1025021231 7:55481599-55481621 TTGACTCAATACATCATTTATGG + Intronic
1026022771 7:66722852-66722874 CTGAATCTGTACATCATTTTAGG + Intronic
1026062725 7:67040397-67040419 TTGACCCAGTATATCAATATGGG - Intronic
1026496397 7:70907386-70907408 ATGAGCCAGTTCATCAATCTGGG - Intergenic
1026568849 7:71512056-71512078 GTGAGTCAGTACATCAGCCTGGG - Intronic
1026591976 7:71704438-71704460 TTGAATCTCTAGATCAATTTAGG - Intronic
1026669574 7:72377247-72377269 TTGAGTCTGCAGGTCAATTTGGG + Intronic
1026715624 7:72787018-72787040 TTGACCCAGTATATCAATATGGG + Intronic
1027587171 7:80072982-80073004 TTGAATCTGTAGATCACTTTGGG - Intergenic
1027611845 7:80370772-80370794 TTGAAACAGTACGTCACTTTGGG + Intronic
1027917163 7:84339908-84339930 TTTATTCAATACATTAATTTGGG + Intronic
1028131353 7:87178046-87178068 TTGAATTTGTACATCAACTTGGG + Intronic
1028288396 7:89033545-89033567 TTAAGTCAGTACATTAATTATGG - Intronic
1028344666 7:89764511-89764533 TTGAATCTGTAGATCAATTTGGG - Intergenic
1028486721 7:91366765-91366787 TTGAATCTGTACATCAATTTAGG + Intergenic
1028543722 7:91974667-91974689 TTGAATCTGTAGATGAATTTGGG + Intronic
1028628078 7:92899589-92899611 TTGAATCTGTAGATCAGTTTGGG + Intergenic
1029039893 7:97562073-97562095 TTGAGTCTATACATTACTTTGGG - Intergenic
1029472997 7:100766324-100766346 TTCAGTCACTACATCATTTCTGG - Intronic
1029916709 7:104217508-104217530 TTGAATCTACACATCAATTTGGG - Intergenic
1030242278 7:107341449-107341471 TTGAGTCTGTAGATTACTTTGGG - Intronic
1030250049 7:107433263-107433285 TTAAATCTGTAGATCAATTTGGG - Intronic
1030340301 7:108371795-108371817 TTGAATCTGTAGATCACTTTGGG - Intronic
1030399980 7:109037361-109037383 TTGAATCTGTAGATAAATTTGGG + Intergenic
1030423523 7:109340477-109340499 TTGAATCTGTACATCAAGTTGGG + Intergenic
1031091075 7:117355370-117355392 TTGAATTTGTAGATCAATTTGGG - Intergenic
1031308357 7:120162639-120162661 TTGAGTCCATAGATCAACTTGGG + Intergenic
1031672934 7:124573227-124573249 TTGAATCAATAGATTAATTTGGG + Intergenic
1031894525 7:127333645-127333667 TTGAATCTGTAGATCACTTTGGG - Intergenic
1031924405 7:127625055-127625077 TTGAGTCTATAGATCAAGTTGGG + Intergenic
1032288229 7:130560410-130560432 TTGAATCTATAAATCAATTTGGG - Intronic
1032374513 7:131397666-131397688 TTGAGCCAGTATATGAATTCAGG + Intronic
1032771418 7:135061947-135061969 TTGAATCTGTAGATCACTTTGGG + Intronic
1033004047 7:137540958-137540980 TTGAGTCTATAGATCAACTTGGG - Intronic
1033005429 7:137556742-137556764 TTGAATTGGTACATTAATTTTGG - Intronic
1033382642 7:140838536-140838558 TTGAATCTGTAGATCAACTTGGG - Intronic
1033797591 7:144865906-144865928 TTGGATCTGTAGATCAATTTGGG + Intergenic
1034024969 7:147691492-147691514 TTGAATCTGTAGATCAAGTTAGG - Intronic
1034053841 7:148013596-148013618 ATGATTCAGTAATTCAATTTTGG - Intronic
1034606583 7:152321846-152321868 TTGAATCTGTAGATCACTTTGGG - Intronic
1034714684 7:153230571-153230593 TTGAGTCAGTAAATTACTTTGGG + Intergenic
1034738395 7:153450649-153450671 TTGAATCAGGCCATTAATTTGGG + Intergenic
1034791214 7:153971047-153971069 TTAACTCTATACATCAATTTTGG + Intronic
1034846244 7:154448502-154448524 TTGAATCTGCACATCAGTTTAGG - Intronic
1035090005 7:156302164-156302186 TTGAGTCTGTAGATCACTTTGGG - Intergenic
1035110464 7:156477442-156477464 TTGAATCTGTAGATCACTTTTGG - Intergenic
1035150342 7:156865502-156865524 TTGAATATGTAGATCAATTTGGG - Intronic
1035309755 7:157958826-157958848 TTGAATCTGTAGATCACTTTGGG - Intronic
1036004952 8:4651801-4651823 TTGGTTCAGTAAATCAAATTAGG - Intronic
1036466356 8:9001607-9001629 GTGAGTCAGTTTATCAATCTGGG + Intergenic
1036718117 8:11145776-11145798 TTGAGTTAGCAGATCAGTTTTGG - Intronic
1036837407 8:12085548-12085570 TTAAATCTGTAAATCAATTTGGG - Intergenic
1036859198 8:12331792-12331814 TTAAATCTGTAAATCAATTTGGG - Intergenic
1037119876 8:15270398-15270420 TTGAATCTGTAGATCACTTTTGG - Intergenic
1037968465 8:23152792-23152814 TTGAATCTGTAGATCACTTTGGG - Intronic
1038092367 8:24268729-24268751 TTGAATCATCACATCATTTTAGG - Intergenic
1038171661 8:25140236-25140258 TTGAATCTGTAGATAAATTTGGG - Intergenic
1038172503 8:25149518-25149540 TTGACTCCATAAATCAATTTGGG - Intergenic
1038407338 8:27331781-27331803 CTAAATCAGTACATTAATTTAGG - Intronic
1038789119 8:30651660-30651682 TTGAATCTATAAATCAATTTGGG - Intronic
1038989359 8:32849432-32849454 TTGAATCTGTAGATCACTTTGGG + Intergenic
1039618749 8:38977478-38977500 CTGAGTCAGCACATCTATCTGGG - Intronic
1039664527 8:39510400-39510422 TTAAATCTGTAGATCAATTTGGG - Intergenic
1039668870 8:39572664-39572686 TTGAATCTGTAGATCACTTTGGG + Intergenic
1039805820 8:40997139-40997161 TTGAATCTGTAGATCAATTTAGG + Intergenic
1039924873 8:41920624-41920646 TTGAGTCTATAGATCAAGTTGGG - Intergenic
1039939842 8:42080638-42080660 CTGAATCAGTAGATCAGTTTGGG + Intergenic
1040583866 8:48721381-48721403 TTGAGTCTGTACATCACTTTGGG - Intronic
1040642077 8:49346839-49346861 TTGAATCTGTACATCAATGTGGG + Intergenic
1040994239 8:53385806-53385828 TTGAATCTATAAATCAATTTAGG + Intergenic
1041027968 8:53706454-53706476 TTTAATCTGTACATTAATTTGGG - Intergenic
1041033760 8:53765703-53765725 TTGAATCTGTAAATCAAGTTGGG - Intronic
1041078995 8:54197097-54197119 TTGAATCTGTTCATCACTTTTGG + Intergenic
1041206441 8:55503251-55503273 CTGAGTCTGTAGATCACTTTGGG + Intronic
1041297918 8:56379146-56379168 TTCAATCTGTAGATCAATTTGGG + Intergenic
1041470370 8:58201784-58201806 TTGAATCTGTAAATAAATTTGGG - Intronic
1041519099 8:58734880-58734902 TTGAATCTGTAGATCACTTTGGG + Intergenic
1041553680 8:59128779-59128801 TTGACTCAGTAGATCATTGTGGG - Intergenic
1042152819 8:65807102-65807124 CTGAATCTGTAGATCAATTTGGG + Intronic
1042258668 8:66833561-66833583 TTGACTCTGTAGATCAATTTGGG + Intronic
1042418231 8:68552270-68552292 TTAAATCTGTAAATCAATTTGGG + Intronic
1042474277 8:69228601-69228623 TTGAATCTATAGATCAATTTGGG - Intergenic
1042617555 8:70666940-70666962 TTGAGTCTGAAGATCAAGTTTGG + Intronic
1042628905 8:70793919-70793941 TTGAATCACTAAGTCAATTTGGG + Intergenic
1042689072 8:71476646-71476668 TTGAATGTGTAGATCAATTTGGG - Intronic
1042778135 8:72458299-72458321 TTAAATCTGTAAATCAATTTAGG + Intergenic
1043295541 8:78657862-78657884 TTGAGTGAGGACAGCAAGTTAGG + Intergenic
1043945065 8:86240635-86240657 TTGAATCTGTAAATGAATTTGGG - Intronic
1043952184 8:86321596-86321618 TTGTGTCAGCACAACGATTTTGG + Intergenic
1044001800 8:86891652-86891674 TTGAATCTGTAGATCACTTTTGG + Intronic
1044040342 8:87358979-87359001 TTGAATCAGTAGATGAATTAAGG - Intronic
1044116349 8:88340180-88340202 TGGTGTGAGTACAGCAATTTCGG - Intergenic
1044251791 8:90011516-90011538 TTGAATCTGTATATCAATTTAGG + Intronic
1044411686 8:91891263-91891285 TTGAATCTGTAGATCAATTTAGG - Intergenic
1044498376 8:92919289-92919311 TTAAATCAGTAGATCACTTTGGG + Intronic
1044620184 8:94183180-94183202 TTGAATCAGTAGATAAACTTGGG - Intronic
1044998923 8:97863344-97863366 TTGAATCTGTAGATCAATTTGGG + Intergenic
1045588813 8:103569425-103569447 TTGAATCTGTAGGTCAATTTAGG + Intronic
1045612516 8:103862537-103862559 TTGAGTCTGTAGCTTAATTTGGG + Intronic
1045847363 8:106654121-106654143 TTAAATCAGTAGATCAATATGGG - Intronic
1046024112 8:108701828-108701850 TTGAATCTATAGATCAATTTGGG - Intronic
1046350846 8:113009288-113009310 TAGATTCAGTACAAGAATTTTGG + Intronic
1046423790 8:114019319-114019341 TTGACTGAGTAAATCAATGTTGG + Intergenic
1046460819 8:114533234-114533256 TTGAATCAGTACTGCACTTTGGG + Intergenic
1046680705 8:117166531-117166553 TTGAGTCAGTATATCTTATTGGG + Intronic
1047132892 8:122041048-122041070 TTGATTCTATAAATCAATTTGGG + Intergenic
1047165059 8:122429278-122429300 TTGAATCTGTAAATCACTTTGGG - Intergenic
1047557984 8:125953990-125954012 TTGAATCTATACATCACTTTGGG - Intergenic
1047633365 8:126732261-126732283 TTGAATCTGTAGATTAATTTGGG + Intergenic
1047867093 8:129037189-129037211 TTGAATCTACACATCAATTTGGG - Intergenic
1047890694 8:129304804-129304826 TTGAATCTGTAGATCAACTTGGG + Intergenic
1047899130 8:129400693-129400715 TTGAATCTATACATTAATTTGGG - Intergenic
1047914747 8:129570420-129570442 TTGAATCTGTACATCTATTTGGG - Intergenic
1047917521 8:129598493-129598515 TTGAATCTCTAAATCAATTTGGG + Intergenic
1047932290 8:129741408-129741430 TTGAATCTGTAGATCACTTTGGG + Intergenic
1048115953 8:131522667-131522689 TTGAATCTGTAGATCACTTTGGG + Intergenic
1048187793 8:132260073-132260095 TTGACTCTGTAGATAAATTTGGG - Intronic
1048576795 8:135698003-135698025 TTGAATCTGTAAATCAGTTTTGG + Intergenic
1048612959 8:136043549-136043571 TTTAGCCAGTACAACAATTTTGG + Intergenic
1048669279 8:136698002-136698024 TTGAATCTGTACATTACTTTGGG + Intergenic
1050426856 9:5520007-5520029 TTGAATCCATAGATCAATTTGGG - Intronic
1050452309 9:5796134-5796156 TTGAGTCTGTAGATCAAGGTGGG - Intronic
1050910715 9:11065822-11065844 TTGAGCCTATAAATCAATTTGGG + Intergenic
1051317600 9:15858484-15858506 TTGAATCTGTAAATCACTTTGGG + Intronic
1051427575 9:16949028-16949050 TTGAATCTGTAGATCAATTTAGG + Intergenic
1051427588 9:16949396-16949418 TTGAATCTGTAGATCAATTTCGG - Intergenic
1051454555 9:17240028-17240050 TTGAATCAGTAGATCAGTTTGGG + Intronic
1051615792 9:19005207-19005229 TTGAATCTGTAGATCACTTTGGG - Intronic
1051654506 9:19365993-19366015 TTCAATCTGTAAATCAATTTAGG - Intronic
1051957201 9:22710533-22710555 TTAAATCTGTACATCAATTTGGG + Intergenic
1052143626 9:25021154-25021176 TTGAATCAATACATTACTTTGGG + Intergenic
1052241799 9:26281980-26282002 TTGAATCTGTAAATCACTTTGGG - Intergenic
1052525430 9:29612470-29612492 TTGAATCTGTAAATCACTTTGGG - Intergenic
1053317787 9:37067145-37067167 TTGAATCCGTAGATCATTTTAGG - Intergenic
1053322188 9:37108892-37108914 TTGAATCTGTAGATCATTTTGGG - Intergenic
1053398086 9:37793092-37793114 TTGAATCTGTATTTCAATTTTGG - Intronic
1053425577 9:38007896-38007918 TTGAGTCAGGACCTCAAGCTTGG + Intronic
1053521706 9:38786657-38786679 TTGAATCAGTAAATCACTTTGGG - Intergenic
1054193872 9:62010646-62010668 TTGAATCAGTAAATCACTTTGGG - Intergenic
1054644535 9:67578045-67578067 TTGAATCAGTAAATCACTTTGGG + Intergenic
1054941648 9:70749215-70749237 TTTATTCAGTACATCAATTCAGG - Intronic
1055050083 9:71970769-71970791 TTGAGTCTGTAGATCAGTTTGGG + Intronic
1055525103 9:77125202-77125224 TTCAGTGAGTACTTCAATTTGGG - Intergenic
1055545086 9:77362681-77362703 TTGAATCTGTAAATCAATTTGGG + Intronic
1055546249 9:77377018-77377040 TTGAATCTGTAGTTCAATTTGGG + Intronic
1056155249 9:83828402-83828424 TTGAATCTGTAGATCAATTTGGG - Intronic
1056163939 9:83924031-83924053 TGGACTCAAGACATCAATTTGGG - Intergenic
1056355237 9:85794711-85794733 TTGAATCTGTAGATCAATTTGGG + Intergenic
1056457621 9:86776890-86776912 TTGACTCTCTAGATCAATTTGGG + Intergenic
1056588256 9:87943138-87943160 TTGAATCTGTAGATCAATTTGGG + Intergenic
1056652107 9:88474360-88474382 TAGAGGCAGTACATTAATCTTGG + Intronic
1056738565 9:89231987-89232009 TTAAGTCTATAGATCAATTTAGG - Intergenic
1056959390 9:91108947-91108969 TTGAGTCAGTAAATTGCTTTAGG - Intergenic
1057002608 9:91526269-91526291 TTGAATCTGTAGATCACTTTGGG - Intergenic
1057808373 9:98237830-98237852 TTGAATCTGTAGATCAATTTGGG + Intronic
1057838094 9:98463318-98463340 CTGAATCTGTAGATCAATTTAGG - Intronic
1057990669 9:99766338-99766360 TAGAGTTAGTACATAAATTTAGG + Intergenic
1058303194 9:103402142-103402164 TTGAGTCTCTAGATCACTTTGGG + Intergenic
1058589956 9:106554690-106554712 TTGAATCAGTAAATCACTTAGGG - Intergenic
1059019706 9:110562064-110562086 TAGGGACAGTACATCAAATTGGG + Intronic
1059090654 9:111354506-111354528 TTGAATCTGTAGATCAACTTGGG + Intergenic
1059347784 9:113642648-113642670 TTGAATCTGTAGATCAATTTGGG + Intergenic
1059394084 9:114020381-114020403 TTGAATCTGTAGATCAATTTGGG + Intronic
1059564518 9:115370161-115370183 TTTAGTCAGTATGTCAAATTTGG + Intronic
1059720651 9:116957000-116957022 TTGAATCAGTACATCCTTGTGGG - Intronic
1059780891 9:117525916-117525938 CAGAGTCAGAACATCAGTTTTGG + Intergenic
1059815904 9:117914729-117914751 TTGAATCTGTAGATCACTTTGGG - Intergenic
1059900941 9:118924211-118924233 TTGAATCTGTAAATCACTTTGGG + Intergenic
1060373166 9:123093844-123093866 TGGAATCTGTAGATCAATTTGGG + Intronic
1060433647 9:123573351-123573373 TTGAATCTATAGATCAATTTAGG + Intronic
1060447142 9:123700309-123700331 TTGACTCTATAGATCAATTTGGG + Intronic
1060546287 9:124462485-124462507 TTGACTGTGTATATCAATTTGGG + Intronic
1060865531 9:126992582-126992604 TTGAATCTGTAGATCCATTTGGG + Intronic
1061018738 9:127999795-127999817 CTGAATCTGTACATCACTTTGGG + Intergenic
1061905992 9:133698343-133698365 TTAGGTCTGTAGATCAATTTGGG - Intronic
1062236345 9:135510832-135510854 TTGAATCTGTACATCAGTTGGGG - Intergenic
1062335583 9:136064642-136064664 TTGAGTCTGTAGATAAATTCGGG - Intronic
1062594455 9:137292446-137292468 TTGAATCTGTAGATGAATTTGGG + Intergenic
1062604616 9:137340844-137340866 TTGACTCTATAAATCAATTTAGG - Intronic
1203437287 Un_GL000195v1:151389-151411 TTAAGTCTGTAGATCACTTTGGG + Intergenic
1185470566 X:379763-379785 TTGAATCTGTGGATCAATTTAGG - Intronic
1186291284 X:8102656-8102678 TTGAATCTCTAGATCAATTTTGG - Intergenic
1186657021 X:11623806-11623828 TTGAATCCGTAAATCACTTTGGG - Intronic
1186677956 X:11840136-11840158 TTGAATCTGTAGATCAGTTTGGG + Intergenic
1186899214 X:14035493-14035515 TTGAATCTGTAGATCATTTTGGG - Intergenic
1186971674 X:14852119-14852141 TTATGTCAGTACATTAATGTAGG - Intronic
1186976057 X:14906011-14906033 CTGAATCAGTAGATCAATTTGGG - Intronic
1187214189 X:17259938-17259960 TTGAATCTGTAGATCACTTTGGG - Intergenic
1187305630 X:18093092-18093114 TTGAATCTGTAGATCATTTTGGG + Intergenic
1187371561 X:18712227-18712249 TTGAATCTGTAGATCAATTTGGG + Intronic
1187379872 X:18791303-18791325 TTGAATCTGTAGGTCAATTTGGG + Intronic
1187609176 X:20921626-20921648 TTGAATCTGTAGACCAATTTGGG + Intergenic
1188152346 X:26693808-26693830 TTGAATCTGTAGATCACTTTGGG + Intergenic
1188170663 X:26920250-26920272 TTGAATCTGTAGATCACTTTGGG - Intergenic
1188180936 X:27054672-27054694 TTGAATGTATACATCAATTTTGG + Intergenic
1188523531 X:31064331-31064353 TTGAATCTGTAGATCACTTTGGG - Intergenic
1188577495 X:31669884-31669906 TAGAGTCTGTAGATCAATTGGGG + Intronic
1189123400 X:38419402-38419424 TTGAATCTGTAGATCACTTTGGG + Intronic
1189361443 X:40356225-40356247 TTGAATCTGAAGATCAATTTGGG - Intergenic
1189596802 X:42575053-42575075 TTGAATCTGTGGATCAATTTTGG + Intergenic
1189670099 X:43399547-43399569 TTAAATAAGTAGATCAATTTTGG - Intergenic
1189769498 X:44409790-44409812 TTGAGTCTATAGATCAATTTGGG - Intergenic
1190257994 X:48778760-48778782 TCAAGTCTGTAGATCAATTTGGG - Intergenic
1190418947 X:50208393-50208415 TTGATTCTGTAGATCAATCTGGG + Intronic
1190419374 X:50213154-50213176 TTGATTCTGTAGATCAATCTGGG + Intronic
1190451990 X:50591460-50591482 TTGAATCTGTAGATCAATTTGGG + Intergenic
1190488760 X:50959455-50959477 TTGCATCTGTACATCACTTTGGG - Intergenic
1190500904 X:51077748-51077770 TTGAATACGTAGATCAATTTTGG + Intergenic
1190547855 X:51548301-51548323 TTGAATGTATACATCAATTTGGG + Intergenic
1190554649 X:51621455-51621477 TTGAATCTGTACATTAATTTGGG + Intergenic
1190627272 X:52348367-52348389 TTAAATCTATACATCAATTTGGG + Intergenic
1190700677 X:52987253-52987275 TGAAATCTGTACATCAATTTGGG - Intronic
1190815992 X:53929919-53929941 TTAAGTCTGTAGATCAATTTGGG - Intergenic
1190849614 X:54225729-54225751 TTGACTCTATATATCAATTTGGG - Intronic
1191071324 X:56403343-56403365 TTGACTCAGTACATGCATGTGGG - Intergenic
1191126533 X:56961100-56961122 TTGATTCTGTAGATCACTTTGGG - Intergenic
1191684520 X:63875976-63875998 TTGAATCTGTAGATCAAGTTGGG - Intergenic
1191730280 X:64326617-64326639 TTGAATCTGTAGATCACTTTGGG - Intronic
1191830793 X:65413854-65413876 TTGAATCTGTAGATCACTTTAGG + Intronic
1191911313 X:66153314-66153336 TTGAATCTGTAGATCATTTTGGG + Intergenic
1192281379 X:69689733-69689755 TTTAATCTGTAGATCAATTTAGG + Intronic
1192303408 X:69930958-69930980 TTGAATCTATAGATCAATTTTGG - Intronic
1192375864 X:70561078-70561100 TTGAATCTATAGATCAATTTGGG + Intronic
1192384964 X:70658684-70658706 TTGAATCTGTAGATCACTTTGGG - Intronic
1192391706 X:70735648-70735670 TTGAATCTGCAGATCAATTTGGG - Intronic
1192399458 X:70819993-70820015 TTGAATCTGTAGATCATTTTAGG - Intronic
1192413466 X:70955503-70955525 CTAAGTCTGTAGATCAATTTAGG - Intergenic
1192540687 X:71969092-71969114 TTGAATCTGTAGATAAATTTGGG + Intergenic
1192678731 X:73229122-73229144 TTGAATCAGTAGATCAATCTGGG + Intergenic
1192887942 X:75356874-75356896 TTGAATCTGTAAATCACTTTGGG + Intergenic
1193359590 X:80564892-80564914 TTGAATCTGTACATCACTTTTGG - Intergenic
1193503681 X:82311620-82311642 TTGAATCTTTAGATCAATTTGGG + Intergenic
1193517999 X:82493627-82493649 TTGAATCTGTACATCACTTTGGG - Intergenic
1193633581 X:83920472-83920494 TTGAATCTGTACATTACTTTCGG + Intergenic
1193692652 X:84666529-84666551 TTGAGTCTGTACATCACTTTGGG + Intergenic
1193723246 X:85011910-85011932 TTGAATCCGTAGATCACTTTTGG + Intronic
1193986495 X:88247666-88247688 TTGAATCTGTAGATCAATTTGGG + Intergenic
1194073542 X:89359287-89359309 TTGAATCTGTAAATCACTTTGGG + Intergenic
1194113547 X:89868783-89868805 TTGAATTCGTACATCATTTTGGG - Intergenic
1194121352 X:89967031-89967053 TTGAATCTGTACATTTATTTGGG + Intergenic
1194327445 X:92537434-92537456 TTGAATCAATAGATTAATTTAGG - Intronic
1194577126 X:95627014-95627036 ATGAGTCAGTTTATCAATCTGGG - Intergenic
1194760076 X:97785566-97785588 TTGAATCTATACATCAACTTGGG - Intergenic
1194864094 X:99044215-99044237 TTGAATCAATATATCAAGTTGGG + Intergenic
1194929873 X:99874222-99874244 TTGAATCCATAGATCAATTTTGG - Intergenic
1195204960 X:102589018-102589040 TTGGATCTGTAAATCAATTTGGG + Intergenic
1195309066 X:103612699-103612721 TTAAGTCTGTAAATCAATTAGGG - Intronic
1195331365 X:103804588-103804610 TTGATTCTATAGATCAATTTGGG + Intergenic
1195587339 X:106579931-106579953 TTGAATCTGTAGATCAAGTTGGG - Intergenic
1195609068 X:106843773-106843795 TTGAATCTGTAGATCAATTTCGG + Intronic
1195612099 X:106879121-106879143 TTGAATCTGTAGATCACTTTGGG - Intronic
1195800762 X:108706698-108706720 TTGAATCTGTACATCACTTTGGG + Intergenic
1195957967 X:110354092-110354114 TTGAATCTGTAGATCACTTTGGG - Intronic
1196040601 X:111198894-111198916 TTGAATCTGTACATTACTTTGGG + Intronic
1196043885 X:111235522-111235544 TTGAATCTGTATATTAATTTGGG - Intergenic
1196058344 X:111380722-111380744 TTGAATCAGTAGGTCAATTTGGG + Intronic
1196082240 X:111645400-111645422 ATGAGTCAGTTTATCAATCTGGG + Intergenic
1196113915 X:111977068-111977090 TTGAATCTGTAGATCACTTTGGG - Intronic
1196182561 X:112708414-112708436 TTGAAGCTGTAGATCAATTTAGG + Intergenic
1196333720 X:114504508-114504530 TTGAATCTGTAGATCACTTTGGG - Intergenic
1196507652 X:116466684-116466706 TTGACTCTGTAGATCACTTTGGG + Intergenic
1196557946 X:117112904-117112926 TTGAATCTGTAGATCACTTTAGG - Intergenic
1197156797 X:123278990-123279012 TTGAGTCTGTAGATCACTTTGGG + Intronic
1197291116 X:124659552-124659574 TTGAATCTGTAAATCAATTTGGG - Intronic
1197683299 X:129409731-129409753 TTGAATCTATACATCAATTTGGG - Intergenic
1197730835 X:129808143-129808165 TTGAATCTATAGATCAATTTGGG - Intronic
1198021361 X:132661613-132661635 TTGAATCTGTATATCAAATTTGG - Intronic
1198049813 X:132939872-132939894 TTAAATCTGTAGATCAATTTTGG - Intronic
1198195893 X:134361471-134361493 TTGAATCTGTAGATCAATTTGGG - Intergenic
1198268055 X:135029180-135029202 TTGAATCTATACATCAATTTTGG + Intergenic
1198513817 X:137383730-137383752 TTGAGTCTGTAGATCAATTTAGG - Intergenic
1198724414 X:139662280-139662302 TTCAATCTGTATATCAATTTAGG - Intronic
1198726503 X:139683408-139683430 TTGAATCTGTAGATGAATTTAGG - Intronic
1198813015 X:140555110-140555132 TTGAATCTGTACATTACTTTGGG - Intergenic
1199014313 X:142794807-142794829 TTGAATCCATAGATCAATTTGGG + Intergenic
1199034765 X:143036832-143036854 TTGAATCTGTACCTCGATTTGGG + Intergenic
1199083260 X:143600498-143600520 TTGAATCTGTAGATCACTTTAGG - Intergenic
1199118665 X:144024218-144024240 TTAAATCAGTATATCATTTTGGG - Intergenic
1199250476 X:145656120-145656142 TTGAATCTGTAGATCACTTTGGG - Intergenic
1199276732 X:145952766-145952788 TTGAATCTGTAAATTAATTTGGG - Intergenic
1199560206 X:149153996-149154018 TTGACTCTGTACATTAATTTGGG + Intergenic
1199753966 X:150847428-150847450 TTGAATCTGTAGTTCAATTTGGG + Intronic
1199781508 X:151065032-151065054 TTGGATCTGTAGATCAATTTTGG + Intergenic
1199784987 X:151097328-151097350 TTGGATCTGTAGATCAATTTTGG - Intergenic
1199820873 X:151444176-151444198 TTGAATCCATAGATCAATTTGGG + Intergenic
1199883087 X:151991730-151991752 TTGAATCTATAAATCAATTTTGG + Intergenic
1199901808 X:152181104-152181126 TTTAATCTGTACATCAGTTTGGG + Intronic
1200297589 X:154937846-154937868 TTGATTCTGCAGATCAATTTGGG - Intronic
1200304915 X:155014849-155014871 TTGAATCTGTAGATCAATTTGGG - Intronic
1200387235 X:155905959-155905981 TTGAATCTGTAGATCAATTAGGG + Intronic
1200466231 Y:3523824-3523846 TTGAATTCGTACATCATTTTGGG - Intergenic
1200474209 Y:3624482-3624504 TTGAATCTGTACATTTATTTGGG + Intergenic
1200636157 Y:5656659-5656681 TTGAATCAATAGATTAATTTAGG - Intronic
1200728923 Y:6710864-6710886 TTGAATCTGTAAATCACTTTGGG + Intergenic
1201316623 Y:12653589-12653611 TTGAATCTGTAGATCAATTTGGG + Intergenic
1201321459 Y:12702672-12702694 TTGAATCTGTAAATCACTTTGGG + Intronic
1201385126 Y:13432155-13432177 TTGAGTCTGTAGATTATTTTGGG - Intronic
1201612208 Y:15855815-15855837 TTGAGTCTGTAAATTACTTTGGG - Intergenic
1201986365 Y:19972640-19972662 TTGAGTCCATAAATCACTTTGGG - Intergenic