ID: 1147129307

View in Genome Browser
Species Human (GRCh38)
Location 17:38397252-38397274
Sequence TCCCCACTGGAACCACAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 187}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147129307_1147129309 12 Left 1147129307 17:38397252-38397274 CCTCTCTGTGGTTCCAGTGGGGA 0: 1
1: 0
2: 1
3: 30
4: 187
Right 1147129309 17:38397287-38397309 TTACGCTTATTCTTTGCCACAGG 0: 1
1: 0
2: 1
3: 4
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147129307 Original CRISPR TCCCCACTGGAACCACAGAG AGG (reversed) Intronic
900946033 1:5831925-5831947 TGCCCACTGGAAGCCCAGACGGG + Intergenic
901497207 1:9629054-9629076 TCCCCACTGTCACCCCAGTGAGG + Intergenic
904111991 1:28133421-28133443 GCCCCACTGGACCCACCGACTGG + Intergenic
904474646 1:30757136-30757158 TCCCCACTGGAGGCACAAAGGGG + Intronic
904483027 1:30805878-30805900 TCCCCATTTGAGGCACAGAGAGG - Intergenic
904607423 1:31705367-31705389 TCCTCACTGGGACCACAGTGGGG - Intergenic
905301018 1:36986140-36986162 TTCCCTCTGGAAGCTCAGAGAGG - Intronic
906246999 1:44283291-44283313 TAGCCACTGGAGACACAGAGAGG + Intronic
907486903 1:54784339-54784361 TGACCTCTGGCACCACAGAGAGG + Intronic
907765226 1:57403230-57403252 TTCCCAATGGATCCACAGAATGG - Intronic
908156479 1:61358731-61358753 TCCCTGCTGGAACCTCAGAAAGG - Intronic
908667360 1:66508244-66508266 TCCTGACTGGAACCACAAAGGGG + Intergenic
913223691 1:116679942-116679964 TCAGCAATGGAACCACAGAAAGG + Intergenic
914912300 1:151797413-151797435 TCCCCACTGAAAGTTCAGAGTGG + Intergenic
919185829 1:194147976-194147998 TCCCCATTGCAAACACAGTGTGG - Intergenic
920087820 1:203430662-203430684 TCCCCACTGGAGTCACAGGGAGG + Intergenic
920977602 1:210800657-210800679 TCCCCACTGCACTCAGAGAGAGG - Intronic
920987660 1:210905683-210905705 ACCCCACTGGGAACACCGAGAGG - Intronic
924076375 1:240341979-240342001 TCTCTACTGGAAACCCAGAGTGG - Intronic
1064152866 10:12879524-12879546 TCCCCACTGGAACCAGGGACAGG - Intergenic
1065813289 10:29462300-29462322 TCCCAGCTGGGAGCACAGAGAGG - Exonic
1065814823 10:29473984-29474006 TTCCCACTGCAAACACAGAATGG + Exonic
1067286560 10:44911613-44911635 TGCACACTGGCACCACAGATAGG + Intronic
1069543869 10:69315633-69315655 TCAGCACTGGAACAACAGAGAGG + Intronic
1070178376 10:73992039-73992061 TCCCCACGTGAACCACACAGCGG - Intergenic
1073299003 10:102459364-102459386 TCCCCACTGGATACCCAGGGAGG + Intergenic
1074049867 10:109871787-109871809 TCCCGACTGGAACCAAAGGTAGG - Exonic
1076018354 10:127047693-127047715 TCCTAACAGAAACCACAGAGTGG - Intronic
1078765414 11:14292215-14292237 TGCCCACTAGAACCCCAAAGAGG - Intronic
1079527768 11:21411283-21411305 GCCCCAGTGAAACCACAAAGTGG - Intronic
1080940365 11:36910867-36910889 TGCCCAGTGGAACCTCATAGAGG - Intergenic
1081842358 11:46211864-46211886 TCCCCACTGTCACCACAGAATGG + Intergenic
1083758156 11:64802345-64802367 TCCCCTCTGGTACCCCAGTGGGG + Intronic
1084068412 11:66718693-66718715 TCCCCAGTGGAACCTCAGGCTGG + Intronic
1088310911 11:108459487-108459509 TTGCCATTGGAACCCCAGAGAGG - Intronic
1088422798 11:109667713-109667735 TCCCCACCTGAAACATAGAGGGG - Intergenic
1088805127 11:113345439-113345461 TTCCCACTGGGAACACAGAGCGG - Intronic
1088878416 11:113954777-113954799 TCCTGACTGGAATCTCAGAGGGG - Intergenic
1089153685 11:116384790-116384812 TCCCCATTGCATCCTCAGAGCGG + Intergenic
1089337519 11:117735178-117735200 TCCCCACTGGAAGGTCAGATGGG + Intronic
1089338116 11:117739607-117739629 TACCCACTAGAACCCCACAGTGG + Intronic
1090178474 11:124673216-124673238 TCCCCAAGGGCACCACTGAGGGG + Intronic
1092523799 12:9297444-9297466 TCCCCCCTGGGGCCTCAGAGGGG + Intergenic
1092543499 12:9434455-9434477 TCCCCCCTGGGGCCTCAGAGGGG - Intergenic
1093022801 12:14218885-14218907 TCCCCACTGGGACCTCAGTTTGG + Intergenic
1094477600 12:30853518-30853540 TCACCCCTGGAACCAAAAAGGGG + Intergenic
1094499273 12:31008019-31008041 AGCTCCCTGGAACCACAGAGAGG + Intergenic
1099708498 12:86188454-86188476 ACCAAACTGGGACCACAGAGAGG - Intronic
1101831816 12:108263779-108263801 TCCCCACTGTAACCCCAAGGTGG + Intergenic
1102867079 12:116382955-116382977 TTCCCACTCGATCCTCAGAGAGG - Intergenic
1103978050 12:124716615-124716637 TGGCCACTGGTCCCACAGAGTGG - Intergenic
1104680332 12:130746704-130746726 TCCCCACTCTAGCCACAGAGTGG - Intergenic
1105280180 13:18958748-18958770 TCCCCATTGGAGCTTCAGAGGGG + Intergenic
1107437133 13:40389951-40389973 TCCCCAGAGGTACCACAGAGAGG - Intergenic
1109928879 13:69185682-69185704 TCTCCACTAGAAACACACAGAGG + Intergenic
1112400014 13:99068246-99068268 TCTCCACTGAAAACTCAGAGAGG - Intronic
1114554908 14:23556304-23556326 TCCTCGCGGGACCCACAGAGGGG - Exonic
1114692535 14:24597674-24597696 TCCCCACTGAAAACACAGATTGG - Intergenic
1114902995 14:27088947-27088969 TCACCAGTGGAATGACAGAGAGG + Intergenic
1116034981 14:39616810-39616832 TCCCCACTGCAGTCACAAAGAGG - Intergenic
1116082944 14:40199391-40199413 TTCCCACCAGAACCACAGAGAGG - Intergenic
1116681360 14:47973878-47973900 CCCCCACTTAAAGCACAGAGAGG + Intergenic
1120299056 14:82682093-82682115 TTCCCAAAGAAACCACAGAGGGG + Intergenic
1121225000 14:92315224-92315246 TCTGCACTGAAACAACAGAGGGG - Intergenic
1121378436 14:93436042-93436064 TGCACACTGGAGACACAGAGAGG - Intronic
1122297621 14:100714141-100714163 TTCCCTCTGCAACCACAGAGTGG + Intergenic
1123682658 15:22773712-22773734 TCCCCACAGAAACAACAGAACGG - Intronic
1124204828 15:27708081-27708103 ACCCCACTGAAACAACAGACAGG - Intergenic
1124230388 15:27940314-27940336 TCCCTACTGGACCCCCAGAAAGG + Intronic
1125990414 15:44101212-44101234 TCCACCCTGGCATCACAGAGTGG - Intronic
1126678480 15:51182336-51182358 TCCTCACTGGGACCACTGGGAGG - Intergenic
1126993960 15:54418364-54418386 TCCCCACTAAAACGACATAGGGG - Intronic
1129974700 15:79812520-79812542 TCCCCACTGGAACTCCAGGAGGG - Intergenic
1131823121 15:96293069-96293091 TTCCCACTGGAGCCACACTGAGG + Intergenic
1132407793 15:101554798-101554820 TCCCCAGAGGAGCCACAGCGAGG + Intergenic
1132652311 16:1027065-1027087 TCCCCACAGGACCCACAGAGCGG + Intergenic
1132950858 16:2561813-2561835 TCCCCTATGTAACCAGAGAGCGG + Exonic
1132963491 16:2638357-2638379 TCCCCTATGTAACCAGAGAGCGG - Intergenic
1133090335 16:3399238-3399260 TCCCCACCAGAACCAATGAGAGG - Intronic
1133487373 16:6233369-6233391 TCCCCACTGCAACCACCCGGGGG - Intronic
1134038642 16:11051114-11051136 TCATCACTGGAAGGACAGAGAGG + Intronic
1134802809 16:17101013-17101035 TCCCCATTAGACACACAGAGGGG - Intergenic
1135429697 16:22373220-22373242 GCCCCACTGGCCCCAAAGAGTGG + Intronic
1137557244 16:49478399-49478421 TCTTCACTGATACCACAGAGGGG - Intergenic
1139393342 16:66620317-66620339 TCCCCTCTGCTCCCACAGAGAGG - Intronic
1139953470 16:70682656-70682678 TCCCCACGGTAACCACATAAAGG + Intronic
1140980304 16:80102452-80102474 TCTCCAATGGAACAACAGAGAGG - Intergenic
1141219082 16:82052225-82052247 TGCCCACCTGAACAACAGAGAGG - Intronic
1141656989 16:85421767-85421789 TCCCACCAGGAACCCCAGAGAGG + Intergenic
1141698416 16:85631489-85631511 ACCCCACTGGAGCCACAATGGGG - Intronic
1143251503 17:5526504-5526526 TTCCCACAGGCAGCACAGAGAGG + Intronic
1143256513 17:5561801-5561823 TCCCCACTTGGACAGCAGAGGGG + Intronic
1143787398 17:9266173-9266195 TGACAACTGGAAACACAGAGGGG + Intronic
1144189851 17:12834591-12834613 TCCCCACTGCCAACACAGTGTGG - Intronic
1147129307 17:38397252-38397274 TCCCCACTGGAACCACAGAGAGG - Intronic
1152441284 17:80311742-80311764 TGCTCACTGGAAGCACCGAGAGG - Intronic
1152664407 17:81559019-81559041 TCCAGACTGGAAACGCAGAGCGG - Exonic
1156203191 18:34857155-34857177 TCCCCGATGGAATCACAAAGAGG + Intronic
1157033545 18:43943240-43943262 TCAGCACTGACACCACAGAGAGG + Intergenic
1157106549 18:44779532-44779554 TCCCCAGTGTAACCACGGACAGG - Intronic
1157597429 18:48872290-48872312 TCCCCACTGGGAACACAGGAAGG - Intergenic
1160015230 18:75135147-75135169 CCCCCACAGCAGCCACAGAGTGG + Intergenic
1160024070 18:75204634-75204656 TCCCCACCGCCACCACGGAGAGG + Intronic
1160170421 18:76548501-76548523 TCCACTCTGGAAGGACAGAGCGG - Intergenic
1160411559 18:78678512-78678534 TCTCCCCTGGAGCCCCAGAGGGG - Intergenic
1160514389 18:79470537-79470559 TCCCCACAGGCAGCACAGGGAGG + Intronic
1161381798 19:3969460-3969482 TCCCCACAGGAAACACACAGAGG + Intronic
1161531521 19:4792680-4792702 TCCCCAGAGGAACCACTGAACGG + Exonic
1163184014 19:15623775-15623797 TCCCCACTGTAGCCCCAGACTGG - Intronic
1163597486 19:18228564-18228586 TCGCCCCTGGGACTACAGAGGGG - Intronic
1163810064 19:19425594-19425616 ACCCAACTGGAACAAGAGAGCGG - Intronic
1164794646 19:31015863-31015885 TGACCACAGGAAGCACAGAGAGG + Intergenic
1165550941 19:36585136-36585158 TCCCCACTACAAACTCAGAGAGG - Intronic
1166884817 19:45953933-45953955 GCTCAACAGGAACCACAGAGCGG - Exonic
1167556504 19:50199468-50199490 TACCCACAGGACCCACAGAGGGG + Intronic
1168245233 19:55109825-55109847 TCCACACAGGAGCCTCAGAGGGG - Intronic
1168245511 19:55111498-55111520 TCCCCATTTCAACCAAAGAGGGG + Intronic
1168538737 19:57192682-57192704 TCCTCACTGACCCCACAGAGCGG - Intronic
1168706762 19:58474730-58474752 AATCCACTGAAACCACAGAGGGG + Intronic
924983406 2:244956-244978 TGCCCACTGAGACCACGGAGGGG - Intronic
929727167 2:44442237-44442259 TCTCCACTAGAGCCACAGATGGG - Intronic
933979109 2:87536326-87536348 TCCCCAGTGGGACCGCAGTGTGG - Intergenic
934219592 2:90069983-90070005 TCTCCCCTGGAGTCACAGAGAGG - Intergenic
934698976 2:96423459-96423481 TCTCCACTGCAAACAAAGAGCGG - Intergenic
934698987 2:96423534-96423556 TCCCCACTTGAAACAAAGTGAGG - Intergenic
936314718 2:111414466-111414488 TCCCCAGTGGGACCGCAGTGTGG + Intergenic
937223929 2:120357419-120357441 TCCTCACAGGAACCACAGAAGGG + Intergenic
937453182 2:122019166-122019188 TCCTCACTGGAAACACAGTGGGG + Intergenic
938249876 2:129806419-129806441 GCCCCACCGGCACCACAGAGAGG + Intergenic
938893001 2:135724077-135724099 TCCCCACTGCCACAGCAGAGGGG - Exonic
940705069 2:157094710-157094732 TCCCCACTGGGAACACTGAGGGG - Intergenic
943810661 2:192184443-192184465 TCCCCATTGGAGCCACACACAGG + Exonic
945167151 2:206958174-206958196 TCCCTCTTGAAACCACAGAGTGG + Intronic
947567641 2:231204822-231204844 TGTCCACAGGAACCACACAGTGG + Intronic
947639159 2:231696637-231696659 TCCCCTCACGCACCACAGAGGGG - Intergenic
1168956479 20:1837824-1837846 TCCCCACTGCAGCCACGAAGAGG - Intergenic
1169698847 20:8424010-8424032 TGCCCTCTGGAAGAACAGAGGGG + Intronic
1171399842 20:24865741-24865763 TGCCCTCAGGAAACACAGAGTGG + Intergenic
1171562604 20:26138521-26138543 TCCCAACTTCAACCACAGAAGGG - Intergenic
1171849045 20:30295203-30295225 TTCCCTCTGGAACCACAGACAGG + Intergenic
1172753992 20:37270725-37270747 ACTGCACTGTAACCACAGAGGGG - Intergenic
1175553643 20:59832654-59832676 TCACTCCTGGAACCCCAGAGCGG - Intronic
1176648734 21:9527148-9527170 TCCCCACTTCAACCCCAGAAAGG + Intergenic
1177566866 21:22834759-22834781 TCACAACTGTAATCACAGAGAGG + Intergenic
1178368429 21:32007120-32007142 TCACCACTTGAAAGACAGAGAGG + Intronic
1182100127 22:27651735-27651757 TCCCCAGTGGACCCAGGGAGAGG + Intergenic
1184365709 22:44049867-44049889 TCCCCACCAGAGCCACACAGAGG - Intronic
950247744 3:11437383-11437405 TCCCCACAGCAAGCACAGAGGGG - Intronic
952778195 3:37067093-37067115 TCCTCACTGGAAAAACAGAAGGG + Intronic
961034402 3:123632332-123632354 TTTCCACTGGAAACAGAGAGGGG + Intronic
963361505 3:144279126-144279148 CCATCACTGAAACCACAGAGAGG - Intergenic
963975266 3:151473300-151473322 TTCTCACTGGGAACACAGAGAGG - Intergenic
964499061 3:157328045-157328067 TTCCCAATTGAGCCACAGAGAGG - Intronic
965548436 3:169938879-169938901 AACCCAATGAAACCACAGAGAGG + Exonic
965635802 3:170779072-170779094 TCCTCTCTGGTACCAGAGAGTGG + Intronic
966945254 3:184773297-184773319 TCCCCACTGAAAGCTCTGAGTGG - Intergenic
967895246 3:194390111-194390133 TACTCAATGGAACCCCAGAGAGG + Intergenic
968968958 4:3783658-3783680 TCCCCACGGCAGCCACAGTGAGG + Intergenic
972247704 4:37262806-37262828 TACCCTCTGCAACCTCAGAGAGG - Intronic
972638602 4:40905901-40905923 TCCCCACTCGAGCCACACAAGGG - Intronic
974096647 4:57371538-57371560 TCCAGCCTGGAGCCACAGAGTGG - Intergenic
982431561 4:155327688-155327710 TCCCCTCTACAACCACAGAGGGG - Intergenic
987425869 5:17772312-17772334 CCTCCACTGATACCACAGAGTGG + Intergenic
987606625 5:20144166-20144188 TGCCCTCTGGAACCTCAAAGAGG - Intronic
987903873 5:24050749-24050771 TCCCCATAGGAACCACAGTTGGG - Intronic
989360717 5:40598392-40598414 TCAGCACTGGAACTAGAGAGAGG + Intergenic
990951376 5:61301883-61301905 TCACCACTGGACCCACAGCCTGG - Intergenic
993880910 5:93359857-93359879 TGCCCAGTGGAAACACAGAGCGG - Intergenic
997452730 5:133996407-133996429 CCCATACTGGAAGCACAGAGGGG + Intronic
1001140335 5:169138710-169138732 GCACGAGTGGAACCACAGAGGGG - Intronic
1001721972 5:173864407-173864429 TCTCAACTGGAACCCTAGAGAGG - Intergenic
1002081808 5:176741817-176741839 TCCCGGCTGCAACCAAAGAGTGG + Intergenic
1002419487 5:179138181-179138203 TCCCCACAGGAACCCCAGGAGGG - Intronic
1002781119 6:367129-367151 TGCCCACTGGAGCAAAAGAGGGG - Intergenic
1005983547 6:30855891-30855913 TCACCACTGGAACCCTGGAGAGG - Intergenic
1006922293 6:37634862-37634884 TCCCCTCAGGATCCATAGAGTGG - Exonic
1009055881 6:58334452-58334474 TCCAAACTTCAACCACAGAGTGG - Intergenic
1011348988 6:86401827-86401849 TCCCCACTGGAACTGCCTAGTGG - Intergenic
1020110247 7:5443691-5443713 TGTCCACTGGAACCTCAGATAGG + Intronic
1020763489 7:12294315-12294337 TCCCCCCTGGAACCCAAGAATGG + Intergenic
1021827241 7:24567377-24567399 TCCCCATTGAAAACACAGACAGG - Intergenic
1022742617 7:33137449-33137471 CCCCCACTGGCTCCGCAGAGTGG + Intronic
1024522964 7:50323295-50323317 TCCCCACTTGGACCCTAGAGTGG + Intronic
1025275206 7:57576895-57576917 TCCCCACTTCAACCCCAGAAAGG + Intergenic
1028671671 7:93407717-93407739 TCCCAACTGGGAAGACAGAGTGG + Intergenic
1031433241 7:121699367-121699389 TCCATACTGGACTCACAGAGAGG - Intergenic
1034298421 7:149994290-149994312 TCCCCACAGAAACTAAAGAGGGG + Intergenic
1035648908 8:1249277-1249299 TTCCCACGGGACCCACAGAGAGG - Intergenic
1037813053 8:22097993-22098015 CCCCCACTGGGACCGCAGGGTGG - Intronic
1038447636 8:27614932-27614954 TCCCTACTGGAAGCGCCGAGCGG - Exonic
1038521451 8:28235849-28235871 TCTCCACTGACACTACAGAGAGG - Intergenic
1041854711 8:62438426-62438448 TGCCCCCAGGAGCCACAGAGAGG - Intronic
1042903955 8:73754545-73754567 TGACCACTGGATGCACAGAGAGG - Intronic
1043282742 8:78488799-78488821 ATCCCACTGGAACCAAAGTGGGG - Intergenic
1047850533 8:128852345-128852367 TACCAACTGCAACCACAGAATGG + Intergenic
1048692144 8:136978358-136978380 ACCCCACTGGAAACACACACAGG + Intergenic
1049798903 8:144508838-144508860 GGCCCCCTGGAGCCACAGAGCGG - Intergenic
1053786765 9:41657923-41657945 TTCCCTCTGGAACCACAGACAGG + Intergenic
1054158295 9:61656272-61656294 TTCCCTCTGGAACCACAGACAGG - Intergenic
1054478068 9:65587277-65587299 TTCCCTCTGGAACCACAGACAGG - Intergenic
1055135408 9:72824014-72824036 TCTTCACTGGACTCACAGAGGGG + Intronic
1056310899 9:85339870-85339892 TGCCCACTGGACCCTCAGTGGGG - Intergenic
1056657665 9:88522508-88522530 TCCCCACTGGCCACACAGAAGGG - Intergenic
1057584848 9:96320030-96320052 TCCCCACTGGAACTGGAGTGCGG - Intergenic
1058062105 9:100509023-100509045 TCCCCATTTGATCCACAGACAGG - Exonic
1060591366 9:124819102-124819124 TCCGCACAGGAGCCACGGAGCGG + Intergenic
1060917979 9:127402689-127402711 GCCCCACAGGAACCGCAGGGCGG - Exonic
1061279110 9:129586892-129586914 TGCCCACTGGAGCCACAGCCTGG - Intergenic
1061409934 9:130414927-130414949 TCACCACTGTCACCACTGAGTGG + Intronic
1061752138 9:132786464-132786486 TCTCCCCTGGACCCCCAGAGAGG + Intronic
1061847078 9:133393861-133393883 TCTCAACTGGAACCCCAGACAGG - Intronic
1062676466 9:137748419-137748441 GCCCCACTGGAACCACCCACAGG - Intronic
1203626470 Un_KI270750v1:30698-30720 TCCCCACTTCAACCCCAGAAAGG + Intergenic
1188511880 X:30944965-30944987 TGCCCACTGGATCCACAATGAGG - Intronic
1188971815 X:36627038-36627060 TCCCAGCTGGAGCAACAGAGAGG - Intergenic
1190263946 X:48816448-48816470 TCAGCACTGGAAGCACAGAGAGG - Exonic
1194473798 X:94334356-94334378 ACACCATTAGAACCACAGAGTGG - Intergenic
1194543814 X:95206609-95206631 TCACCACTGGAGACAAAGAGTGG + Intergenic
1195012962 X:100751592-100751614 TCCCTCCTGGAAACACACAGAGG + Intergenic