ID: 1147131080

View in Genome Browser
Species Human (GRCh38)
Location 17:38409475-38409497
Sequence CTCCGCAAGGGGTTTTTGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147131072_1147131080 -9 Left 1147131072 17:38409461-38409483 CCCTAATGGAGCCCCTCCGCAAG No data
Right 1147131080 17:38409475-38409497 CTCCGCAAGGGGTTTTTGAGAGG No data
1147131073_1147131080 -10 Left 1147131073 17:38409462-38409484 CCTAATGGAGCCCCTCCGCAAGG No data
Right 1147131080 17:38409475-38409497 CTCCGCAAGGGGTTTTTGAGAGG No data
1147131070_1147131080 17 Left 1147131070 17:38409435-38409457 CCAGCTCAGGAGAGGCACTAGCT No data
Right 1147131080 17:38409475-38409497 CTCCGCAAGGGGTTTTTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147131080 Original CRISPR CTCCGCAAGGGGTTTTTGAG AGG Intergenic
No off target data available for this crispr