ID: 1147133140

View in Genome Browser
Species Human (GRCh38)
Location 17:38420422-38420444
Sequence CAGAACAGCCCCAAAGAACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147133140_1147133147 3 Left 1147133140 17:38420422-38420444 CCAAGTTCTTTGGGGCTGTTCTG No data
Right 1147133147 17:38420448-38420470 AAAGCAGTGGCTGGGGGCCCTGG No data
1147133140_1147133150 25 Left 1147133140 17:38420422-38420444 CCAAGTTCTTTGGGGCTGTTCTG No data
Right 1147133150 17:38420470-38420492 GCTCTGAGACCCTCCCCTCCAGG No data
1147133140_1147133142 -6 Left 1147133140 17:38420422-38420444 CCAAGTTCTTTGGGGCTGTTCTG No data
Right 1147133142 17:38420439-38420461 GTTCTGCCTAAAGCAGTGGCTGG No data
1147133140_1147133141 -10 Left 1147133140 17:38420422-38420444 CCAAGTTCTTTGGGGCTGTTCTG No data
Right 1147133141 17:38420435-38420457 GGCTGTTCTGCCTAAAGCAGTGG No data
1147133140_1147133144 -4 Left 1147133140 17:38420422-38420444 CCAAGTTCTTTGGGGCTGTTCTG No data
Right 1147133144 17:38420441-38420463 TCTGCCTAAAGCAGTGGCTGGGG No data
1147133140_1147133145 -3 Left 1147133140 17:38420422-38420444 CCAAGTTCTTTGGGGCTGTTCTG No data
Right 1147133145 17:38420442-38420464 CTGCCTAAAGCAGTGGCTGGGGG No data
1147133140_1147133143 -5 Left 1147133140 17:38420422-38420444 CCAAGTTCTTTGGGGCTGTTCTG No data
Right 1147133143 17:38420440-38420462 TTCTGCCTAAAGCAGTGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147133140 Original CRISPR CAGAACAGCCCCAAAGAACT TGG (reversed) Intergenic
No off target data available for this crispr