ID: 1147139298

View in Genome Browser
Species Human (GRCh38)
Location 17:38452439-38452461
Sequence GTCCAGGAGGAAGCGTCATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 70}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147139298_1147139309 9 Left 1147139298 17:38452439-38452461 CCTTATGACGCTTCCTCCTGGAC 0: 1
1: 0
2: 0
3: 4
4: 70
Right 1147139309 17:38452471-38452493 ATTCAGGAGTGGGGTTGGGCTGG 0: 1
1: 1
2: 5
3: 31
4: 359
1147139298_1147139301 -7 Left 1147139298 17:38452439-38452461 CCTTATGACGCTTCCTCCTGGAC 0: 1
1: 0
2: 0
3: 4
4: 70
Right 1147139301 17:38452455-38452477 CCTGGACTCCTCCTAGATTCAGG 0: 1
1: 0
2: 2
3: 38
4: 228
1147139298_1147139303 -1 Left 1147139298 17:38452439-38452461 CCTTATGACGCTTCCTCCTGGAC 0: 1
1: 0
2: 0
3: 4
4: 70
Right 1147139303 17:38452461-38452483 CTCCTCCTAGATTCAGGAGTGGG 0: 1
1: 0
2: 0
3: 12
4: 152
1147139298_1147139310 28 Left 1147139298 17:38452439-38452461 CCTTATGACGCTTCCTCCTGGAC 0: 1
1: 0
2: 0
3: 4
4: 70
Right 1147139310 17:38452490-38452512 CTGGAGCTGCCCCGCTTTCCTGG 0: 1
1: 0
2: 1
3: 20
4: 182
1147139298_1147139308 5 Left 1147139298 17:38452439-38452461 CCTTATGACGCTTCCTCCTGGAC 0: 1
1: 0
2: 0
3: 4
4: 70
Right 1147139308 17:38452467-38452489 CTAGATTCAGGAGTGGGGTTGGG 0: 1
1: 0
2: 0
3: 15
4: 188
1147139298_1147139307 4 Left 1147139298 17:38452439-38452461 CCTTATGACGCTTCCTCCTGGAC 0: 1
1: 0
2: 0
3: 4
4: 70
Right 1147139307 17:38452466-38452488 CCTAGATTCAGGAGTGGGGTTGG 0: 1
1: 0
2: 1
3: 19
4: 217
1147139298_1147139302 -2 Left 1147139298 17:38452439-38452461 CCTTATGACGCTTCCTCCTGGAC 0: 1
1: 0
2: 0
3: 4
4: 70
Right 1147139302 17:38452460-38452482 ACTCCTCCTAGATTCAGGAGTGG 0: 1
1: 0
2: 0
3: 7
4: 121
1147139298_1147139304 0 Left 1147139298 17:38452439-38452461 CCTTATGACGCTTCCTCCTGGAC 0: 1
1: 0
2: 0
3: 4
4: 70
Right 1147139304 17:38452462-38452484 TCCTCCTAGATTCAGGAGTGGGG 0: 1
1: 0
2: 2
3: 12
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147139298 Original CRISPR GTCCAGGAGGAAGCGTCATA AGG (reversed) Intronic