ID: 1147139532

View in Genome Browser
Species Human (GRCh38)
Location 17:38453626-38453648
Sequence AGGGGCCGCCCCGGAGGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 560
Summary {0: 1, 1: 0, 2: 5, 3: 37, 4: 517}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147139518_1147139532 21 Left 1147139518 17:38453582-38453604 CCTGGCGTGTGGGGTGTGAGTGT 0: 1
1: 0
2: 5
3: 1089
4: 1792
Right 1147139532 17:38453626-38453648 AGGGGCCGCCCCGGAGGGGGAGG 0: 1
1: 0
2: 5
3: 37
4: 517
1147139517_1147139532 22 Left 1147139517 17:38453581-38453603 CCCTGGCGTGTGGGGTGTGAGTG 0: 1
1: 0
2: 6
3: 1037
4: 927
Right 1147139532 17:38453626-38453648 AGGGGCCGCCCCGGAGGGGGAGG 0: 1
1: 0
2: 5
3: 37
4: 517

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147139532 Original CRISPR AGGGGCCGCCCCGGAGGGGG AGG Intronic
900032557 1:381739-381761 AGAGGCCGCCGCGGTGGGGTGGG - Intergenic
900053314 1:610801-610823 AGAGGCCGCCGCGGTGGGGTGGG - Intergenic
900096768 1:942970-942992 AGGGGCCGGCGCCGAGGGGAAGG + Exonic
900113630 1:1019838-1019860 AGGGGCGGCCCGGGAGGGGGCGG - Intergenic
900240545 1:1615464-1615486 CGGGGGCGCTCCGGCGGGGGCGG + Exonic
900578046 1:3394023-3394045 AGTGTCCGCGCCGGAGGGGAGGG + Intronic
900596402 1:3482043-3482065 AGCGGCCGCCTCGCAGGGCGGGG + Intergenic
900698361 1:4027097-4027119 AGGGGCCGCCACGGAAATGGGGG - Intergenic
900786428 1:4653377-4653399 AGGGGCAGCCAGTGAGGGGGTGG - Intergenic
901529571 1:9844485-9844507 AGGGGCTGGCCGGGAGGGAGGGG + Intergenic
901660747 1:10796439-10796461 AGCGGCAGCCCCGGGGGTGGGGG + Intronic
901666682 1:10830288-10830310 AGGGGCGGCGCCGGGGTGGGGGG - Intergenic
901795523 1:11677278-11677300 AGGGGCTGCCCCAGAGGGTTCGG - Intronic
902451459 1:16499242-16499264 AGGGGCCGCACCGGGTGCGGCGG + Intergenic
902823244 1:18956244-18956266 GGGGGCTGCCCTGGCGGGGGCGG - Exonic
903177923 1:21591580-21591602 AGGGGTCTCCCTGGAGGTGGCGG - Intergenic
904015677 1:27418554-27418576 TGGGGCTTCCCCAGAGGGGGAGG - Intronic
904326126 1:29727931-29727953 AGGGGTCGGCCCGGGGGAGGTGG + Intergenic
904659285 1:32072846-32072868 AGGGGCCGCCCGGACGGAGGCGG - Intronic
904750986 1:32741579-32741601 TGGGGCCGCCCGGGAGGGGGCGG - Intergenic
905851455 1:41277927-41277949 TGGGGCCCCCCCGGAGGGTTTGG + Intergenic
905906017 1:41619013-41619035 GGAGGCTGCCCTGGAGGGGGCGG - Intronic
907962520 1:59296763-59296785 AGGGGCCGCGCCGGCGGGGGCGG + Intronic
908581918 1:65525547-65525569 AGGGGCGGCTGCGGAGGGCGCGG + Intronic
914824786 1:151132855-151132877 TGGGGCCGCCCAAGAGGGCGGGG + Exonic
914834905 1:151198857-151198879 GAGGGAGGCCCCGGAGGGGGCGG + Exonic
915246398 1:154558766-154558788 CGGGGCCGCCTAGGAGGAGGAGG - Intronic
915552248 1:156642039-156642061 GGGGGCGGCCCCGGGGAGGGCGG + Exonic
919101826 1:193105440-193105462 GGGGGCCGGGCCGGAGGAGGCGG - Intronic
920295664 1:204954651-204954673 AGGGGCCGCCCTTGAGAGGCAGG - Intronic
920409652 1:205749597-205749619 AGGGGACGGCCCCGAGGAGGTGG + Intronic
920571167 1:207019071-207019093 AGGGGCCGCCCTGTAGGCTGGGG - Exonic
921944975 1:220880028-220880050 GGGGGCGGCCCCGGAGGGCCTGG + Exonic
922718694 1:227889523-227889545 AGGGGCAGACCAGGAGGGGATGG - Intergenic
923372457 1:233327636-233327658 AGGGGCGGGCCCGGGGGGGTGGG + Intergenic
923611985 1:235504145-235504167 AGGGCCGGCCCCGGAGGCGCAGG + Exonic
924100220 1:240595444-240595466 AAGGGCTGCCCAGGAGGAGGGGG - Intronic
924674008 1:246157163-246157185 AGGGGGCGCCCCGAAGGGACAGG - Intronic
924957660 1:248944878-248944900 CGGCGCCTCCCCGGAGGGGAGGG - Intergenic
1062843677 10:689381-689403 GGGGCCGGGCCCGGAGGGGGAGG - Intronic
1063389523 10:5640251-5640273 TGGTGCCGACCCGGAGGTGGTGG + Exonic
1063663653 10:8049719-8049741 AGGGGCCGAGGCGGAGGAGGGGG + Intergenic
1064112344 10:12550072-12550094 AGGGGCAGCCCAGGAGGAGAGGG + Intronic
1064230988 10:13529057-13529079 AGGGGCGCCGGCGGAGGGGGCGG + Intergenic
1064354283 10:14603989-14604011 GGGGGGCGCCGCGGAGGCGGGGG - Intronic
1066198209 10:33122317-33122339 AGGGTCCACCCCGGAGAGGCTGG + Intergenic
1066464166 10:35639313-35639335 AGGGGGCGCCCAGGAGGGGTGGG - Exonic
1066745476 10:38602029-38602051 AGGGGCAGCCTGGGAGGGGCAGG + Intergenic
1070079116 10:73168234-73168256 AGGGGCCGGGCCGGAGCCGGCGG + Exonic
1070539485 10:77406056-77406078 AGAGGAGGCCCAGGAGGGGGAGG + Intronic
1073099600 10:100999784-100999806 CGGGGGCGCCGCGGAGGCGGAGG + Exonic
1076721935 10:132396766-132396788 AGGGCTGGGCCCGGAGGGGGAGG + Intergenic
1076963504 10:133786396-133786418 CGGCGCCTCCCCGGAGGGGAGGG - Intergenic
1076981872 11:208960-208982 GGGGGCGGGCACGGAGGGGGTGG + Intronic
1077383341 11:2257580-2257602 AGGGAGCGCCCCGGGGAGGGAGG - Intergenic
1077464706 11:2728191-2728213 AGTGGCCGCTCCAGAGGTGGAGG - Intronic
1077479652 11:2807665-2807687 AAGGGGGGCCCTGGAGGGGGTGG - Intronic
1078067938 11:8090136-8090158 ATGGGCGGCCCCGGAGCCGGCGG + Exonic
1078210417 11:9265406-9265428 AGGCGCCGTCTGGGAGGGGGCGG + Intergenic
1078800988 11:14643975-14643997 AGGGGGCGCCCCGAACGCGGGGG + Exonic
1080551377 11:33376319-33376341 AGGAGCCGGCCCGGGGGAGGGGG + Intergenic
1081488219 11:43547782-43547804 GGGGGCTTCCCCGGGGGGGGGGG + Intergenic
1081810946 11:45913893-45913915 AGGGCCTGACCCGGAGGGAGCGG - Exonic
1081814980 11:45934025-45934047 AGGGGCCGGCGTGGAGGTGGCGG + Exonic
1082076594 11:47980402-47980424 CGCGGCCGGCTCGGAGGGGGCGG + Intergenic
1083220447 11:61248967-61248989 AGGGGAGGCCCCGAAGGGGAGGG - Intronic
1083265763 11:61546209-61546231 AGTGGCCGCCGCGGCGGGGCTGG - Exonic
1083319880 11:61839052-61839074 AGGGGCAGGGCCGGACGGGGAGG - Intronic
1083615228 11:64022796-64022818 AGGGGCCTCACTGGAGGGTGAGG + Intronic
1084733330 11:71088741-71088763 AGGGGCGGCCCCTGGTGGGGTGG - Intronic
1084733346 11:71088795-71088817 AGGGGCAGCCCCTGGTGGGGTGG - Intronic
1084733405 11:71089011-71089033 AGGGGCGGCCCCTGGTGGGGTGG - Intronic
1086887745 11:92224605-92224627 AGGGGGCGCGCGGGAGGGGGCGG - Intergenic
1087672751 11:101127544-101127566 GGGGGCCGCCCCGGCGGCGGCGG + Exonic
1087743426 11:101915200-101915222 AGGGGCCGAGCAGGAGGAGGAGG + Exonic
1088579204 11:111299569-111299591 AGGGGCCGCCCCGGGGCTGGCGG - Exonic
1089132724 11:116224925-116224947 TGGGGCCCCCCCGCAGGAGGGGG + Intergenic
1089249057 11:117144511-117144533 AGGGGCCGCAAGGGTGGGGGAGG - Intronic
1089253061 11:117179046-117179068 AGGGGGCGGCCGGGAGGGGGCGG - Exonic
1096228041 12:49881889-49881911 AGGGGCAGCACCTGAGGGGGTGG - Intronic
1096291987 12:50351319-50351341 AAGGGCTGCCCTGGAGTGGGAGG + Exonic
1097316144 12:58173380-58173402 AGGGGCCATCCTAGAGGGGGAGG - Intergenic
1099989845 12:89709643-89709665 AAGGGGCGCGCTGGAGGGGGCGG - Intergenic
1100830969 12:98516219-98516241 AGGGGGCGCCCGGGAGGGAGGGG - Intronic
1101150340 12:101877632-101877654 AGGCCCAGCCCCGGAGGGAGGGG - Exonic
1101673496 12:106897641-106897663 GGGGGCTGCACAGGAGGGGGTGG + Intergenic
1102007368 12:109597136-109597158 AGGGGCTGTCCCGGAGGCGGTGG + Exonic
1102151016 12:110689171-110689193 GGGGGCGGCCCGGGCGGGGGCGG - Intronic
1102182083 12:110920439-110920461 AGGGACCACGGCGGAGGGGGAGG - Intronic
1102463145 12:113112566-113112588 AGGGGCAGCCTCGCAGGGGAGGG - Intronic
1102527084 12:113519946-113519968 AGGGGCGGCTTGGGAGGGGGAGG + Intergenic
1102655501 12:114479659-114479681 AGGGGACGCCCAGGGAGGGGAGG - Intergenic
1102887514 12:116533333-116533355 GGGGCCCACGCCGGAGGGGGCGG - Intergenic
1103521320 12:121538150-121538172 CGGGGCCGCCAGGGAGGCGGAGG + Intronic
1104882783 12:132084179-132084201 AGGGGGCGGGGCGGAGGGGGCGG - Intergenic
1105071225 12:133235586-133235608 AAGGGGGGCCCCGGAGGGTGAGG - Exonic
1105813776 13:24015711-24015733 AGGGGTCGCCCCAAAGGGGAAGG - Intronic
1106190742 13:27450424-27450446 AGGGGGCGCCCCTGTGGAGGAGG - Intronic
1106539086 13:30674197-30674219 AGCGGCCGCCGCGGGGGGAGAGG + Intergenic
1107212071 13:37869819-37869841 AGGGGCGGCCCGGGAGGGGGAGG + Exonic
1107438404 13:40402591-40402613 AGGGGCAGCTGCGGAGGGCGTGG - Intergenic
1107853502 13:44592411-44592433 AGAGGCGGCCCTGGAGAGGGTGG - Intergenic
1108088327 13:46818725-46818747 AGGGGAGGCCCTGGAGAGGGTGG - Intergenic
1112012173 13:95301506-95301528 AGCGGGCGCCCCCGAGGCGGCGG - Intergenic
1113312043 13:109141007-109141029 GGGGGCGGCCCGGGCGGGGGCGG - Exonic
1113581070 13:111429476-111429498 AGGGGCAGCCCTGGAGTGGGCGG - Intergenic
1113647203 13:112006960-112006982 AGGGGCTGGCAGGGAGGGGGAGG + Intergenic
1113768321 13:112894282-112894304 CGGGGGCGGGCCGGAGGGGGAGG - Intergenic
1113841263 13:113363087-113363109 CTGGGGCGCCCCGGAGGAGGGGG + Intronic
1113857209 13:113453824-113453846 AGGGCACGCCCCGCAGCGGGCGG - Intergenic
1113989938 13:114353236-114353258 CGGCGCCTCCCCGGAGGGGAGGG - Intergenic
1114255633 14:20999229-20999251 AGGGGCCTCCATGCAGGGGGAGG + Intergenic
1117253600 14:53956867-53956889 AGGGGCCGCCGGGGAAGAGGAGG - Intronic
1119859126 14:77923960-77923982 TGGGGCAGCCCCAGAGGAGGCGG + Intronic
1120951930 14:90049594-90049616 TGGGGCTGCCCCTGATGGGGAGG + Intergenic
1121050442 14:90816337-90816359 AGGGGGCGCCGCGGCGGCGGCGG - Exonic
1121553318 14:94818848-94818870 AGAGGACGCCCTGGAGAGGGTGG + Intergenic
1122140471 14:99660170-99660192 TGGGGCGGCCACGGAGGGAGGGG - Intronic
1122143007 14:99673756-99673778 AGGGGGTGGCACGGAGGGGGTGG + Intronic
1122693361 14:103541747-103541769 AGGGCCATCCACGGAGGGGGAGG - Intergenic
1122712026 14:103665861-103665883 AGGCGCCACCCTGGAGGTGGGGG + Intronic
1122799363 14:104221988-104222010 AGGGGCAGCCCTGGTGGGTGTGG + Intergenic
1122888601 14:104722627-104722649 AGGGGCTGCACCTGAGGGTGGGG - Intergenic
1122924642 14:104894033-104894055 AAGGGCCGCCCTGGAGGCGCTGG - Intronic
1126113112 15:45187183-45187205 AGAGCCAGCCCGGGAGGGGGAGG + Intronic
1127257841 15:57306786-57306808 AGGGGGCGCCCCGGCGCTGGAGG - Intergenic
1128335271 15:66781534-66781556 AGTGGCGGCCCCGGCGGGAGGGG + Exonic
1128424069 15:67521628-67521650 AGGGGCCGTCCCGGCCGGGCGGG - Intronic
1128456417 15:67833995-67834017 CAGGGACGCCCGGGAGGGGGCGG - Exonic
1128742939 15:70096127-70096149 GGGGGCCGCCCCGGGGCTGGCGG - Intronic
1129051313 15:72783891-72783913 TGTTGCCGCCCCGGAGGAGGTGG + Intronic
1129518413 15:76170849-76170871 AGGGGCCACCCGGGGTGGGGTGG + Intronic
1129644697 15:77419725-77419747 CGGGGCCGCCGCCGAGGGAGGGG + Intronic
1129699579 15:77759956-77759978 AGGGCCCACCCCGGAGGGAGGGG + Intronic
1129789245 15:78329772-78329794 AGGGGCAGTCCAGGAAGGGGTGG - Intergenic
1129986357 15:79923091-79923113 CGGGGACGCCCCGGTGGCGGAGG - Intronic
1130076578 15:80695241-80695263 CGGGGCCGGCCCGGCGGGCGCGG - Intronic
1131094810 15:89648492-89648514 GGCGGCCGCCGCGGAGGCGGTGG + Exonic
1131108429 15:89749985-89750007 AAGGGCCGCCGCGGTGGGGACGG + Exonic
1132460864 16:53896-53918 AGGGGCGGCCCTGGAGGAGACGG + Exonic
1132626185 16:892706-892728 AGGGGCCGGCCCGGAGGCCTGGG + Intronic
1132717894 16:1301255-1301277 GGAGGCGGCCCGGGAGGGGGCGG - Intergenic
1132734721 16:1379697-1379719 CGGGGCCAGCGCGGAGGGGGCGG - Intronic
1132804085 16:1767739-1767761 AGGGGCCACGCCAGATGGGGTGG + Intronic
1132894819 16:2223775-2223797 CCGGGCCGACCCGGAGGGTGCGG + Intronic
1132897685 16:2236721-2236743 AGGGGCGGCCGCGGAGGGAAGGG + Exonic
1132915313 16:2340686-2340708 CGTGGCCGCCCTGGAGGGGAGGG + Exonic
1132945499 16:2529683-2529705 TGCGGCCGCCCTGGAGGCGGTGG + Intronic
1132954751 16:2585659-2585681 AGGGGCCGGCGTGGAGGGGCCGG + Intronic
1133056027 16:3145840-3145862 AGGGGGGGCCCCGGCCGGGGAGG + Intronic
1133230014 16:4361954-4361976 AGGGGCAGCCCTGGTGGGGTGGG + Intronic
1133390744 16:5408009-5408031 AGGGGCCACACAGGAGGTGGAGG - Intergenic
1133818320 16:9214919-9214941 AGGGGTCACCCCAGCGGGGGAGG - Intergenic
1136470165 16:30474339-30474361 TGGGGCAGCCCCCGAGGCGGTGG + Intronic
1136493217 16:30624561-30624583 AGGGGCTGCCCAGGAAGAGGAGG + Intergenic
1137542763 16:49376461-49376483 AGGGGCTGCCCTGGAGGAGATGG + Intronic
1137738516 16:50742404-50742426 TGGGGAAGCCCCGGTGGGGGGGG - Intronic
1138478291 16:57284720-57284742 GGGGGCGGCCCCGGCGGCGGGGG - Intergenic
1139475078 16:67199065-67199087 CGGGGCCGCCTCGGCGGGGCGGG + Intergenic
1140043690 16:71425874-71425896 AGGGGCGACCCCGGAGCGAGGGG - Intergenic
1141132232 16:81444585-81444607 AGGGGCAGCCCCTGGGGAGGGGG - Intergenic
1141430458 16:83968352-83968374 AGGGGGCTACCCGGAGGGGAGGG - Intergenic
1141430904 16:83969663-83969685 AGGGGGCGGCTCGGAGGAGGAGG + Intronic
1141685352 16:85566885-85566907 AGGGGCCGCAGCGGAAGGGCCGG + Intergenic
1142240232 16:88941512-88941534 GGGCGCCGCCCCGGTGGCGGAGG - Intronic
1142338808 16:89507853-89507875 GAGGGCAGCCCCGGAGGAGGAGG - Intronic
1142582639 17:951745-951767 AGGGCCAGCCCCAGAGGGGCGGG + Intronic
1142642631 17:1293341-1293363 AGGAGCCGTCACGGAGAGGGAGG + Intronic
1142645040 17:1306046-1306068 TGGGGCCGCCAGGGAGGGGTAGG + Intergenic
1142712577 17:1731302-1731324 AGGGGCTGCCCAGGAGGGGGTGG + Intronic
1143510923 17:7394589-7394611 ACGCACCGCCCAGGAGGGGGCGG - Exonic
1143770157 17:9163315-9163337 AGGAGAAGCCCAGGAGGGGGAGG - Intronic
1143876734 17:9997233-9997255 AGGGGCCGGGCGGGTGGGGGCGG + Intronic
1145041370 17:19580152-19580174 AGCGGCCGCCGCGCAGGGGTGGG + Intergenic
1145064625 17:19753727-19753749 CCCGGCCGCCCCGGAGGGAGTGG - Intergenic
1145214775 17:21043129-21043151 CGGTGCCGGCCGGGAGGGGGGGG - Intronic
1145242856 17:21249730-21249752 AGGGGCTGCCCAGGAGGTGGGGG + Intronic
1145327270 17:21842670-21842692 AGAAGCCGCCGCGGCGGGGGGGG - Intergenic
1146172810 17:30646371-30646393 AGGGGCAGCCTCGGGGGTGGGGG - Intergenic
1146346267 17:32062382-32062404 AGGGGCAGCCTCGGGGGTGGGGG - Intergenic
1146398475 17:32486665-32486687 AGGGGCGGCCCCGAGGGGCGGGG + Exonic
1147139532 17:38453626-38453648 AGGGGCCGCCCCGGAGGGGGAGG + Intronic
1147162220 17:38574885-38574907 CTGGCCAGCCCCGGAGGGGGCGG + Intronic
1147440319 17:40443605-40443627 AGGACCCGACCCGGAGGGCGCGG - Exonic
1147742532 17:42677042-42677064 GGGGGCCCCCCGGGAGGGAGGGG - Intergenic
1148480731 17:47958011-47958033 AGGGACCGCCACGCAGGAGGAGG + Intergenic
1151354883 17:73552461-73552483 AGGGGACCCTCCTGAGGGGGTGG + Intronic
1151479429 17:74361647-74361669 CGCGGCCGGCCAGGAGGGGGCGG - Intronic
1151555214 17:74843174-74843196 AGGGGCGGCCCCGGCGTCGGGGG + Exonic
1151994750 17:77601476-77601498 AGGGGCAGCCCCAGAAGGTGAGG - Intergenic
1152534251 17:80941260-80941282 GGGAGCAGCCCTGGAGGGGGCGG + Intronic
1152549588 17:81022747-81022769 AGGGGCCACCAGGGTGGGGGAGG + Intergenic
1152549599 17:81022767-81022789 AGGGGCCACCAGGGCGGGGGAGG + Intergenic
1152549610 17:81022787-81022809 AGGGGCCACCAGGGCGGGGGAGG + Intergenic
1152549641 17:81022847-81022869 AGGGGCCACCAGGGCGGGGGAGG + Intergenic
1152549652 17:81022867-81022889 AGGGGCCACCAGGGTGGGGGAGG + Intergenic
1152549673 17:81022907-81022929 AGGGGCCACCAGGGCGGGGGAGG + Intergenic
1152549684 17:81022927-81022949 AGGGGCCACCAGGGTGGGGGAGG + Intergenic
1152549695 17:81022947-81022969 AGGGGCCACCAGGGCGGGGGAGG + Intergenic
1152566782 17:81103812-81103834 AGGGGCCCCTGCTGAGGGGGCGG + Intronic
1152581160 17:81166139-81166161 AGAGCCCGCACCGGTGGGGGCGG + Intergenic
1152606785 17:81295377-81295399 AGAGGCGGGCCCGGAGGGGCGGG + Intronic
1152730688 17:81968134-81968156 AGGGGCGGCGGCGGCGGGGGCGG + Intergenic
1152744913 17:82034102-82034124 ATGGGCTTCCCTGGAGGGGGAGG + Exonic
1152896557 17:82914618-82914640 AGGGGCCCCCAGGGAGGGCGTGG - Intronic
1152947383 17:83205443-83205465 AGAGGCCGCCGCGGTGGGGTGGG + Intergenic
1153676419 18:7459859-7459881 AGGGGCTGCCCATGAAGGGGAGG - Intergenic
1153800088 18:8661126-8661148 ATCAGCCGCCCCGGAGGGGAGGG + Intergenic
1153959951 18:10132099-10132121 GGGGGCCGCGGCGGAGCGGGCGG - Intergenic
1153997447 18:10454567-10454589 AGGAGGGGCCCTGGAGGGGGCGG - Intergenic
1154047097 18:10916320-10916342 AGGAGCCGCCTAGCAGGGGGCGG + Intronic
1154161239 18:11981870-11981892 AGGGTCCGCACCCGAGGGCGCGG + Intronic
1155155007 18:23150588-23150610 TGGGGGAGCCCCGGAGGGGTGGG + Intronic
1155519920 18:26657155-26657177 AGCGGCAGCCCCGGAGGAGGCGG + Intronic
1157147003 18:45174092-45174114 AGGGGCTGCCCTGGGGTGGGAGG - Intergenic
1157204627 18:45687777-45687799 AGGGGCGGCCCAGGCCGGGGTGG + Intergenic
1159511247 18:69400823-69400845 AGGGGGCGGGCCGGGGGGGGCGG - Intergenic
1160025393 18:75211674-75211696 CGGGGCCGCTCAGGAGGCGGCGG - Intronic
1160775465 19:853213-853235 AGGGGCGGCCCCGGGGGTCGGGG - Intronic
1160790464 19:920589-920611 AGGGTCCGGGCCGGCGGGGGCGG - Exonic
1160791011 19:923806-923828 AGGGGCCGCGCAGGGGGGTGAGG - Intergenic
1160833074 19:1112322-1112344 AGGGCCCGGCCAGGCGGGGGCGG + Intronic
1160847782 19:1174001-1174023 AGGGGTCGCGGCGGAGGGCGGGG + Intronic
1160869412 19:1270194-1270216 AGGTGCCCCCCAGGACGGGGCGG + Intronic
1160870371 19:1275169-1275191 GGGGGTCGCCCCGAAGTGGGTGG + Intergenic
1161175808 19:2841666-2841688 GGGGGCGGCCCCGGCGAGGGCGG + Intronic
1161374716 19:3933521-3933543 GGAGGCCGCCCCGGGGGAGGCGG - Exonic
1161480982 19:4510563-4510585 AGGGGCCGCCCCAGGCAGGGAGG - Exonic
1161703064 19:5805323-5805345 GGGGCCCGGGCCGGAGGGGGCGG - Intergenic
1162033250 19:7926178-7926200 CGGGGCCGCCGCGGGGGGCGGGG + Intergenic
1162140882 19:8585104-8585126 AGGGCGCGCCCCAGAGGGGTGGG - Intronic
1162403172 19:10458120-10458142 AGGGGCAGGGCTGGAGGGGGTGG + Intronic
1162778656 19:12995631-12995653 AGCGGCGGCCCCGGAGCCGGCGG + Exonic
1162919169 19:13890087-13890109 AGGAGCCCCCCAGGAGGGAGGGG - Exonic
1162934149 19:13972837-13972859 AGTGGCAGCACCGGAGGCGGCGG - Exonic
1163026778 19:14517585-14517607 CGGGGCCGCCTCGGAGGGTAAGG - Intronic
1163420634 19:17211943-17211965 AGGGGCGGCCACGGTGGGGAGGG - Exonic
1163701883 19:18790221-18790243 TCGGGCCGCCCCGGGGCGGGGGG - Intronic
1163758398 19:19120319-19120341 GGGGGCAGCGCCTGAGGGGGTGG - Intronic
1164958317 19:32405716-32405738 AGGGGGCGCGCCGGAGAGGCCGG - Intronic
1165157768 19:33798129-33798151 AGGGGTGGCCCCGGAGAGGCAGG - Intronic
1165361130 19:35337720-35337742 AGGGGCAGTCGGGGAGGGGGCGG - Intronic
1165420599 19:35720224-35720246 AGGGGCCGCGGCCGAGGTGGTGG + Exonic
1165511681 19:36269924-36269946 AGAGGCTGCTCCGGATGGGGAGG - Intergenic
1165512230 19:36272425-36272447 AGAGGCTGCTCCGGATGGGGAGG - Intergenic
1165512777 19:36274966-36274988 AGAGGCTGCTCCGGATGGGGAGG - Intergenic
1165513333 19:36277521-36277543 AGAGGCTGCTCCGGATGGGGAGG - Intergenic
1165513882 19:36280055-36280077 AGAGGCTGCTCCGGATGGGGAGG - Intergenic
1165514435 19:36282592-36282614 AGAGGCTGCTCCGGATGGGGAGG - Intergenic
1165514986 19:36285125-36285147 AGAGGCTGCTCCGGATGGGGAGG - Intergenic
1165515537 19:36287661-36287683 AGAGGCTGCTCCGGATGGGGAGG - Intergenic
1165516088 19:36290198-36290220 AGAGGCTGCTCCGGATGGGGAGG - Intergenic
1165516638 19:36292724-36292746 AGAGGCTGCTCCGGATGGGGAGG - Intergenic
1165517191 19:36295247-36295269 AGAGGCTGCTCCGGATGGGGAGG - Intergenic
1165517743 19:36297782-36297804 AGAGGCTGCTCCGGATGGGGAGG - Intergenic
1165518296 19:36300317-36300339 AGAGGCTGCTCCGGATGGGGAGG - Intergenic
1165518846 19:36302849-36302871 AGAGGCTGCTCCGGATGGGGAGG - Intergenic
1165519395 19:36305364-36305386 AGAGGCTGCTCCGGATGGGGAGG - Intergenic
1165519943 19:36307892-36307914 AGAGGCTGCTCCGGATGGGGAGG - Intergenic
1165624124 19:37270689-37270711 AGAGGCTGCTCCGGATGGGGAGG + Intergenic
1165624670 19:37273231-37273253 AGAGGCTGCTCCGGATGGGGAGG + Intergenic
1165625213 19:37275757-37275779 AGAGGCTGCTCCGGATGGGGAGG + Intergenic
1165626287 19:37280823-37280845 AGAGGCTGCTCCGGATGGGGAGG + Intergenic
1165626826 19:37283350-37283372 AGAGGCTGCTCCGGATGGGGAGG + Intergenic
1165627368 19:37285868-37285890 AGAGGCTGCTCCGGATGGGGAGG + Intergenic
1165628446 19:37290920-37290942 AGAGGCTGCTCCGGATGGGGAGG + Intergenic
1165628983 19:37293448-37293470 AGAGGCTGCTCCGGATGGGGAGG + Intergenic
1165629529 19:37295971-37295993 AGAGGCTGCTCCGGATGGGGAGG + Intergenic
1165630070 19:37298496-37298518 AGAGGCTGCTCCGGATGGGGAGG + Intergenic
1165630613 19:37301024-37301046 AGAGGCTGCTCCGGATGGGGAGG + Intergenic
1165631147 19:37303565-37303587 AGAGGCTGCTCCGGATGGGGAGG + Intergenic
1165773308 19:38390407-38390429 AGGGGCCAGGCCCGAGGGGGGGG + Exonic
1165846636 19:38821824-38821846 AGGCGCCGCCGAGCAGGGGGTGG - Intronic
1166100376 19:40568048-40568070 AGGAGCTGCCCAGGAGGCGGCGG + Exonic
1166676626 19:44745301-44745323 AGGGGCTGCCCCTGCGGGTGGGG + Intergenic
1166824770 19:45601990-45602012 TGAGGCAGCCCCCGAGGGGGCGG + Intronic
1166948957 19:46413677-46413699 GGAGGCCGCCCCGAAGGGAGTGG - Intergenic
1167145813 19:47680456-47680478 CGGGGCCGCTCCGGTGGTGGTGG - Exonic
1167237050 19:48321508-48321530 AGGGGCTTCCCCGTAAGGGGCGG + Intronic
1167249184 19:48391589-48391611 AGGCTCCGCCCCCGAGGGCGGGG + Intergenic
1167290184 19:48620292-48620314 AGGGGCCTCCCTGGCGGGTGGGG - Intronic
1167445291 19:49533890-49533912 CGGGGCCGGCGCGGAGAGGGTGG + Intronic
1167501642 19:49851584-49851606 AGGGGACACCCCGGAGCGGCGGG - Intronic
1167638524 19:50668228-50668250 TGGGGGCGGCCCGGAGGGAGGGG - Exonic
1167638533 19:50668242-50668264 CGGGGCCGCCCTGGTGGGGGCGG - Exonic
1167668445 19:50836384-50836406 AGGGGGCGCCCAGGAGCAGGTGG - Intronic
1167698251 19:51027273-51027295 AGGGGCAGGACCGGAGGGTGGGG + Intronic
1167703448 19:51064942-51064964 AGGGGTCAGGCCGGAGGGGGAGG - Intronic
1167941095 19:52946488-52946510 AGGGCCAGGCCTGGAGGGGGCGG - Intronic
1167952427 19:53037968-53037990 CGGGGCCTCCGCGGAGTGGGGGG + Intergenic
1168286336 19:55336272-55336294 AGCGGCCGCCCCTGAGGGTGGGG - Intergenic
1168340836 19:55622185-55622207 CGGGGTGGCCCCGGAGAGGGCGG - Exonic
1168728639 19:58606850-58606872 CGGCGCCTCCCCGGAGGGGAGGG - Intergenic
925020136 2:562591-562613 TGGGGCTGCCGCGTAGGGGGGGG + Intergenic
925041582 2:735320-735342 TGGGGCCCCCCCGAAGGGGCTGG + Intergenic
926060275 2:9800830-9800852 AGGCACAGTCCCGGAGGGGGTGG - Intergenic
926089993 2:10043517-10043539 CGGGGCGGCCGCGGAGGGAGCGG - Intronic
927870358 2:26619240-26619262 AGGGCCCTCCCCGGGGGGTGAGG + Intronic
929501458 2:42494198-42494220 ACGGGCCGGAGCGGAGGGGGAGG - Intergenic
932234342 2:70109064-70109086 AGGCCCCGCCCCGCTGGGGGTGG - Intergenic
932494379 2:72139175-72139197 AGCGGCTGCCCAGGAGGGGTGGG + Intronic
932607672 2:73175829-73175851 AGGGCCCGCGGCGGCGGGGGCGG + Intergenic
932780088 2:74554239-74554261 CGGGGCGGCCCCGGTGGTGGCGG + Exonic
933220346 2:79680371-79680393 AGGGGCCTCTCAGGAGGGGAGGG + Intronic
934188721 2:89766733-89766755 AGGGGCAGCCTGGGAGGGGCAGG - Intergenic
934307873 2:91841220-91841242 AGGGGCAGCCTGGGAGGGGCAGG + Intergenic
934754609 2:96816508-96816530 CTGGGTGGCCCCGGAGGGGGCGG + Exonic
935013182 2:99154929-99154951 GGGGGCCGGCCCTCAGGGGGCGG + Intronic
935130301 2:100256615-100256637 AGGGGCCGCATCTGACGGGGAGG + Intergenic
936433227 2:112482120-112482142 CGGGGCCGCGCCGGCGGGGGCGG + Intergenic
936569863 2:113603854-113603876 CGGCGCCTCCCCGGAGGGGAGGG + Intergenic
937950870 2:127387497-127387519 AGGGGCGGGCTCGGCGGGGGCGG - Intronic
937954626 2:127415202-127415224 AGGGGCCGACTAGGAGGGGAAGG - Intergenic
941462995 2:165793748-165793770 AGGGGCCGCCCCATAGGGACTGG + Intronic
941905759 2:170715567-170715589 AGGGCCGAGCCCGGAGGGGGCGG + Intronic
942450916 2:176107623-176107645 GGGGGCGGCCCCGGCGGGGGCGG + Exonic
942451089 2:176108170-176108192 GGGGGCCGCGGGGGAGGGGGGGG + Intronic
944570826 2:201042607-201042629 AGGGGCTCCCCCAGACGGGGCGG - Intronic
944766814 2:202872085-202872107 AGGGGCCGCCCCAGAAGGCCCGG - Intergenic
944831060 2:203534813-203534835 AGGGGCCGCCTGGGAGGGTGCGG - Intronic
946081462 2:217123275-217123297 CGGGACAGCCCAGGAGGGGGTGG - Intergenic
946430999 2:219627469-219627491 GGGGGCCGCGCCGGCCGGGGCGG + Intronic
946716490 2:222559164-222559186 AGGGGCCGGGCGGGGGGGGGGGG - Exonic
948150553 2:235741027-235741049 AGGGGGCCCCCCGGAGGCGCAGG + Exonic
948660451 2:239503423-239503445 AGAGGCCGCCCCAAAGGGAGAGG + Intergenic
948764504 2:240212505-240212527 GTGGGCCGCCCCTGAGGCGGGGG + Intergenic
948801562 2:240435636-240435658 AGGGGCCGGGCCGGCGGCGGGGG + Intergenic
948857385 2:240736399-240736421 AGGGGCAGCCCTGGTGGGTGGGG - Intronic
949088898 2:242182487-242182509 CGGCGCCTCCCCGGAGGGGAGGG - Intergenic
1168855067 20:1002353-1002375 AGGAGCCGGCGCGGCGGGGGCGG + Intergenic
1169195823 20:3681617-3681639 CTGGGCTGCCCCCGAGGGGGAGG + Intronic
1169244593 20:4015577-4015599 AGGGGCGGGCCCGCCGGGGGAGG + Intronic
1170287446 20:14725741-14725763 AGTAGCCGCCCCAGAGGGTGAGG + Intronic
1172117982 20:32583316-32583338 CCGGGCGGCCGCGGAGGGGGAGG + Intronic
1172661746 20:36573476-36573498 ACGGCCCGCCCCGCGGGGGGTGG + Exonic
1174246777 20:49187955-49187977 CGGGGCCTTCCCGGAGGAGGCGG - Intronic
1174287382 20:49482845-49482867 AGGGGCCGCCCCTCGGGGCGGGG + Intergenic
1174376197 20:50128260-50128282 AGGAGCCGCCCAGGAGCAGGTGG - Intronic
1174467948 20:50731740-50731762 AGGGGCCGCCCGGCCGGAGGAGG + Exonic
1175366825 20:58461463-58461485 AGGGGCAGGGCCAGAGGGGGCGG + Exonic
1176016802 20:62938116-62938138 GGGGGCCGCGGCGGAGGCGGGGG - Exonic
1176178563 20:63739593-63739615 CGGGAGCGACCCGGAGGGGGCGG + Intronic
1176426321 21:6550813-6550835 AGGTGCTGGCCCGCAGGGGGAGG + Intergenic
1176705643 21:10118668-10118690 AGAGGCTGCTCCGGATGGGGAGG + Intergenic
1178673909 21:34614960-34614982 CGGGGCCGCGGCGGAGGCGGCGG - Exonic
1178690032 21:34743038-34743060 AGGGTCCCCCCAGGAGGGGCTGG + Intergenic
1179213803 21:39349267-39349289 TGGGGGCGCCCGGGGGGGGGGGG - Intronic
1179364069 21:40739308-40739330 AGGGGCAGCCCCAGAGAGGCTGG + Intronic
1179534362 21:42041887-42041909 GGGGGCAGCCCCGGGGGGTGTGG - Intergenic
1179688433 21:43066851-43066873 AGGTGACGCCCCACAGGGGGAGG - Intronic
1179701812 21:43159130-43159152 AGGTGCTGGCCCGCAGGGGGAGG + Exonic
1179799327 21:43803576-43803598 AGGGGCCGACCCCGAGGCGCGGG + Exonic
1179891808 21:44339078-44339100 CGCGGCCGCCCCGGGGTGGGGGG - Intronic
1179981827 21:44899873-44899895 AGGGGCCACACTGGAGGAGGCGG + Intronic
1180259907 21:46662002-46662024 ATGGGGCGCGCAGGAGGGGGTGG + Intronic
1180264122 21:46698769-46698791 CGGCGCCTCCCCGGAGGGGAGGG - Intergenic
1180649915 22:17369398-17369420 AGGGGCCGCCCACGAGGAGGGGG - Exonic
1180831143 22:18906752-18906774 AGGCGCCGACCCCGAGGAGGCGG - Intronic
1180835391 22:18927064-18927086 TGGGGCTGCCCAGGAGTGGGTGG - Intronic
1180960178 22:19758993-19759015 AGGGGCAGCCAGGGAGGAGGTGG + Intronic
1181068696 22:20319590-20319612 AGGCGCCGACCCGGAGGAGGCGG + Intronic
1181235881 22:21447410-21447432 AGGCTCAGCCCCGGAGGGGGCGG - Exonic
1181688417 22:24544578-24544600 AGGGGCTGCCCAGGAAGGGCTGG + Intronic
1181711979 22:24696677-24696699 TGGGGCTGCCCAGGAGTGGGTGG - Intergenic
1183187588 22:36300805-36300827 AGGGGTGGCGCCGGAGGGGCAGG - Intronic
1183662478 22:39229827-39229849 AGAGGCCTGCCCGGCGGGGGTGG + Intronic
1183828366 22:40405410-40405432 TGGGGACGCCCCGGAGTGGGAGG - Intronic
1184106328 22:42369289-42369311 AGGGGCCGGACCGGGGCGGGCGG + Intergenic
1184147931 22:42622450-42622472 AGCAGCCGACCTGGAGGGGGTGG + Intronic
1184225990 22:43129113-43129135 AGGGGAAGCCCAGGAGGGTGGGG - Intronic
1184741333 22:46430552-46430574 AGGGGACCCCCAGGAGGAGGAGG - Intronic
1185055401 22:48576251-48576273 GGGGGGCGCCGCGGAGGGGGCGG - Intronic
1185213188 22:49583485-49583507 AGGAACCGCCCAGGAGGGGAGGG - Intronic
1185285790 22:49999526-49999548 AGGGGCCGCGCGGGAGGGCGGGG + Intronic
1185409386 22:50674302-50674324 GGGGGCTGCGCCGGAGGCGGGGG - Intergenic
1203281230 22_KI270734v1_random:132023-132045 AGGCGCCGACCCCGAGGAGGCGG - Intergenic
1203285479 22_KI270734v1_random:152363-152385 TGGGGCTGCCCAGGAGTGGGTGG - Intergenic
949414493 3:3800243-3800265 AGGGGCCGACCAGGGGAGGGAGG + Intronic
950082676 3:10234706-10234728 AGGGGCCGTCCCCGATGAGGTGG - Intronic
950530262 3:13549036-13549058 AGACCCCGCCCCGGAGGCGGAGG + Intergenic
950703555 3:14766557-14766579 AGGGGCAGCCGGCGAGGGGGAGG + Intronic
952883463 3:37999145-37999167 CGGGGCGGGGCCGGAGGGGGCGG + Intronic
953800312 3:46017888-46017910 AGGGGAAGCCCAGGAGGTGGTGG + Exonic
954378292 3:50206108-50206130 AGGGGCCAACCGGGCGGGGGCGG - Intronic
954638509 3:52084667-52084689 AGGGGCTGCCCCAGAGCTGGGGG - Intronic
959359285 3:105368312-105368334 AGGGGACGTCCCCGAGGGTGTGG - Intronic
961453697 3:127014120-127014142 AGTGGGCGCCCCGGCGGGGTGGG + Intronic
961545298 3:127629144-127629166 AGGGGCCGCGCGGGCGGCGGCGG - Intergenic
961657760 3:128452721-128452743 AGGGGCTGCCCTGGGGGTGGCGG - Intergenic
961800092 3:129440572-129440594 AGGTGCCGCGCCTGAGGTGGTGG + Intronic
962129847 3:132660622-132660644 AGGAGCGGCGACGGAGGGGGCGG + Exonic
965590441 3:170356994-170357016 AGCTGCGGCCCCGCAGGGGGAGG + Intergenic
967390314 3:188948359-188948381 AGGGGCTGGCCCGGAGGGGCTGG - Intronic
967553842 3:190831551-190831573 AGGGGCCGGACAGGAGGCGGTGG - Intergenic
967904143 3:194486922-194486944 GGGCGCCGCCGCGGAGGGGAGGG - Intronic
968292239 3:197547720-197547742 AGGGGCCTCCAGGGAGGGAGAGG - Intronic
968452374 4:681603-681625 CGGGGCGGCGCTGGAGGGGGCGG - Intronic
968452383 4:681623-681645 CGGGGCGGCGCTGGAGGGGGCGG - Intronic
968452392 4:681643-681665 CGGGGCGGCGCTGGAGGGGGCGG - Intronic
968452401 4:681663-681685 CGGGGCGGCGCTGGAGGGGGCGG - Intronic
968452410 4:681683-681705 CGGGGCGGCGCTGGAGGGGGCGG - Intronic
968452419 4:681703-681725 CGGGGCGGCGCTGGAGGGGGCGG - Intronic
968452428 4:681723-681745 CGGGGCGGCGCTGGAGGGGGCGG - Intronic
968603345 4:1520652-1520674 CGGGGCGGCCTCGGAGGGGCTGG - Intergenic
968603364 4:1520693-1520715 CGGGGCGGCCTCGGAGGGGCTGG - Intergenic
968603403 4:1520775-1520797 CGGGGCGGCCTCGGAGGGGCTGG - Intergenic
968603462 4:1520898-1520920 CGGGGCGGCCTCGGAGGGGCTGG - Intergenic
968603481 4:1520939-1520961 CGGGGCGGCCTCGGAGGGGCTGG - Intergenic
968603519 4:1521021-1521043 CGGGGCGGCCTCGGAGGGGCTGG - Intergenic
968603538 4:1521062-1521084 CGGGGCGGCCTCGGAGGGGCTGG - Intergenic
968603557 4:1521103-1521125 CGGGGCGGCCTCGGAGGGGCTGG - Intergenic
968603576 4:1521144-1521166 CGGGGCGGCCTCGGAGGGGCTGG - Intergenic
968603595 4:1521185-1521207 CGGGGCGGCCTCGGAGGGGCTGG - Intergenic
968850489 4:3074617-3074639 CGGGGCCGCGCCGGCGGAGGCGG - Intergenic
968912071 4:3481425-3481447 AGGGCCGGCCCGGGAAGGGGGGG + Intronic
968938247 4:3624668-3624690 AGGAGCAGCCTGGGAGGGGGAGG + Intergenic
969021706 4:4143560-4143582 TGGGGACGCCGCGGAGGAGGAGG - Intergenic
969732161 4:8963855-8963877 TGGGGACGCCGCGGAGGAGGAGG + Intergenic
972437072 4:39044855-39044877 CCGGGTGGCCCCGGAGGGGGCGG - Intergenic
980053834 4:128061655-128061677 CGGGGCCACCCCGGCTGGGGCGG + Intronic
980354194 4:131723367-131723389 AGAGGCTGCTCCGGATGGGGAGG - Intergenic
980355267 4:131728350-131728372 AGAGGCTGCTCCGGATGGGGAGG - Intergenic
980355816 4:131730851-131730873 AGAGGCTGCTCCGGATGGGGAGG - Intergenic
980356354 4:131733342-131733364 AGAGGCTGCTCCGGATGGGGAGG - Intergenic
980356891 4:131735830-131735852 AGAGGCTGCTCCGGATGGGGAGG - Intergenic
980357430 4:131738322-131738344 AGAGGCTGCTCCGGATGGGGAGG - Intergenic
980357970 4:131740811-131740833 AGAGGCTGCTCCGGATGGGGAGG - Intergenic
980358507 4:131743302-131743324 AGAGGCTGCTCCGGATGGGGAGG - Intergenic
980359045 4:131745775-131745797 AGAGGCTGCTCCGGATGGGGAGG - Intergenic
980359582 4:131748246-131748268 AGAGGCTGCTCCGGATGGGGAGG - Intergenic
980360129 4:131750738-131750760 AGAGGCTGCTCCGGATGGGGAGG - Intergenic
980360665 4:131753213-131753235 AGAGGCTGCTCCGGATGGGGAGG - Intergenic
980361208 4:131755693-131755715 AGAGGCTGCTCCGGATGGGGAGG - Intergenic
980361748 4:131758168-131758190 AGAGGCTGCTCCGGATGGGGAGG - Intergenic
980362291 4:131760648-131760670 AGAGGCTGCTCCGGATGGGGAGG - Intergenic
980362834 4:131763131-131763153 AGAGGCTGCTCCGGATGGGGAGG - Intergenic
980377912 4:131975386-131975408 AGAGGCTGCTCCGGATGGGGAGG + Intergenic
980923927 4:139115419-139115441 CGGGGGCGTCCCGGAGGCGGTGG - Intronic
981280646 4:142954589-142954611 AGGGGCCGCGGAGCAGGGGGTGG - Intergenic
985466727 4:190203694-190203716 CGGCGCCTCCCCGGAGGGGAGGG - Intergenic
985477842 5:89876-89898 AGGGCACACCCCGGGGGGGGGGG + Intergenic
985504615 5:271850-271872 CGGGGCCGCCGCGGCGGAGGCGG - Intronic
985549168 5:524489-524511 AGGCTCCGCCCCGGGGCGGGAGG - Intergenic
988825259 5:34929510-34929532 AAGGGCCGCGCGGGAGGGGGTGG - Intergenic
989178727 5:38556244-38556266 AGGGGCGGCCCGGGCGGGGTGGG - Intronic
994367319 5:98929764-98929786 AGGTTCCTCCCCGGAGGGCGGGG + Intergenic
995915158 5:117236635-117236657 GGGGGCCTGTCCGGAGGGGGTGG - Intergenic
996065149 5:119071367-119071389 AGGGCGAGGCCCGGAGGGGGCGG - Intronic
997297458 5:132777036-132777058 AGGGGCCGCCCTGCAGCTGGCGG - Intronic
997980365 5:138464730-138464752 AGGGGCCGCCCAGGAGAGGCGGG - Intergenic
998192935 5:140042551-140042573 AGTGGCCGCTCCGGAGCGGGGGG - Exonic
999322688 5:150624982-150625004 CGGCGCCGCCCAGGAGGAGGTGG + Intronic
999767974 5:154755410-154755432 CCGGGCCGCCCCGGGGGCGGGGG + Intronic
1002416378 5:179122924-179122946 TGGGGCTGCCCCCGAGGGTGGGG - Intronic
1002664151 5:180810421-180810443 AGCGGCCGTACAGGAGGGGGAGG + Intronic
1002741263 5:181437129-181437151 AGAGGCCGCCGCGGTGGGGTGGG + Intergenic
1003099034 6:3163115-3163137 AGGGGCCGCGGCGCAGGGGGAGG + Intergenic
1003175445 6:3750422-3750444 AGGGGCCGCCTGGGAGGGCCGGG - Intronic
1004663362 6:17729083-17729105 AGGCGCCGCGCAGCAGGGGGCGG - Intergenic
1005643946 6:27823993-27824015 AAGTCCCGCCCCGGTGGGGGAGG - Intergenic
1005645250 6:27831637-27831659 AAGTCCCGCCCCGGTGGGGGAGG + Intergenic
1006021550 6:31120730-31120752 AGTGGCCGCCCCAGAGTGGGTGG - Intronic
1006313514 6:33277549-33277571 AGGGGCGGCCCCGGTGAGGCGGG - Exonic
1006337477 6:33428084-33428106 AGGGGTGTCCCCGGTGGGGGAGG - Intronic
1006375807 6:33671110-33671132 AGGGGCCGGCGCGTAGGGGCGGG - Intronic
1006500973 6:34458537-34458559 AGAGGAGGCCCTGGAGGGGGTGG - Intergenic
1006641365 6:35491393-35491415 AGGGGCAGACCAGGAGGGGATGG + Intronic
1006671393 6:35731817-35731839 CGGGGCTGCCCGGGAAGGGGCGG - Intergenic
1007902044 6:45422026-45422048 GGCGGCCGCCGCGGAGGCGGCGG + Intronic
1008760379 6:54846630-54846652 AGGTGCAGCGCTGGAGGGGGCGG - Intergenic
1008883619 6:56408717-56408739 AGGGGCCGGGGCGGGGGGGGGGG - Intergenic
1014109235 6:117602214-117602236 AGGGGCCCCCACGGAGCAGGAGG + Exonic
1015496888 6:133891661-133891683 AGTGGCCGTGGCGGAGGGGGTGG - Intronic
1017880723 6:158560590-158560612 AGAGGCTGCCCGGGAGGCGGCGG - Intronic
1018154537 6:160973426-160973448 AGGGGCCGCCTGGGAGGCTGAGG + Intergenic
1019433928 7:1012203-1012225 AGGGGCCGCCGCGGTGGCCGAGG + Intronic
1019434941 7:1017735-1017757 AGGGGCAGCCGCGGACGGCGGGG + Intronic
1019472792 7:1230193-1230215 AGGGCCCGCGAGGGAGGGGGCGG + Intergenic
1019530078 7:1498949-1498971 CGGGGGCGCCCCGGGGGGGTGGG - Intronic
1019707299 7:2502745-2502767 AGGGGCAGTCCCGAAGGTGGGGG + Intergenic
1019719430 7:2559304-2559326 AGGGGCCGGCCCGGGGCGTGAGG + Intronic
1019738195 7:2660638-2660660 TGGGGACGCCACGGAGGGGGTGG - Intronic
1020046720 7:5046085-5046107 AGGGGCCGGACGGGAGGTGGCGG + Exonic
1020106154 7:5423258-5423280 AGGGGGCGCCCCGGGAGGGGTGG - Intronic
1020117086 7:5481963-5481985 ATGGGTGGCCACGGAGGGGGCGG + Intronic
1020135470 7:5585697-5585719 AGGCGCCACCCCAGAGGAGGTGG + Intergenic
1020204818 7:6105649-6105671 AGCGGCCACCCCGAAGGGAGAGG + Intronic
1021687627 7:23202666-23202688 AGGGGTCATCCCGGGGGGGGGGG - Intergenic
1022427781 7:30284946-30284968 AGCGGCCGCCCGAGAGGAGGCGG + Exonic
1022501300 7:30883746-30883768 AGGAGCAGCCCGGGAGGGAGAGG + Intronic
1023081897 7:36534008-36534030 AGATGCCGCCCCTCAGGGGGAGG - Intronic
1024534497 7:50418772-50418794 AGAGGCCGTCCTGGAGAGGGTGG + Intergenic
1025712475 7:63925809-63925831 TGGGGTCGACCCGGCGGGGGGGG + Intergenic
1026970297 7:74463639-74463661 AGGGGCCACCAAGGAGCGGGTGG + Intronic
1027001429 7:74657389-74657411 CGCGGCCGCCCGGGTGGGGGAGG - Intergenic
1027228596 7:76260038-76260060 AGCGGCCGCCGCGGCGGGGGTGG + Intronic
1029367800 7:100127599-100127621 AGAGGCCGCCCTGGAGGAGGCGG + Exonic
1029720956 7:102364107-102364129 AGGGGCCGGGCGGGAGGTGGTGG + Exonic
1029745584 7:102514222-102514244 AGGGGGCTCCCTGGAGGTGGGGG - Intronic
1029763523 7:102613201-102613223 AGGGGGCTCCCTGGAGGTGGGGG - Intronic
1031134833 7:117873334-117873356 GGGGGCCGCGGCGGAGGCGGCGG - Exonic
1034652952 7:152706586-152706608 AGGTGTGGCCCCTGAGGGGGTGG + Intergenic
1035264594 7:157684329-157684351 TGGAGCCGCCGCGGAGAGGGAGG + Intronic
1035274326 7:157738297-157738319 AGGAGGCGCCCCAGAGGGGAGGG + Intronic
1035285259 7:157801946-157801968 AGGAGCCGCCCCAGAGCGTGCGG - Intronic
1035437518 7:158870170-158870192 AGGGGCCGCAGCGGTGGGTGGGG + Intronic
1035457113 7:159015866-159015888 AGGGGCCGCCCCCGGGCGGTGGG + Intergenic
1035501694 8:94863-94885 AGAGGCCGCCGCGGTGGGGTGGG - Intergenic
1037273658 8:17156297-17156319 AGAGGCCGAGCCGGAGGCGGCGG + Exonic
1037810001 8:22081470-22081492 GGGGGCCGTCCCGGAGCAGGTGG - Exonic
1038149368 8:24928500-24928522 AGGGGAGGCCCTGGAGTGGGTGG - Intergenic
1041532143 8:58881042-58881064 AGGGGCCTCCCCTGTGTGGGAGG + Intronic
1043388147 8:79768004-79768026 AGGGGCGGGCGCGGAGGGCGGGG - Intergenic
1044832876 8:96267460-96267482 AGGGGCAGCACTGGAGGGAGGGG - Intronic
1047620576 8:126602514-126602536 AGGGGCCCTGCTGGAGGGGGAGG - Intergenic
1049056745 8:140242874-140242896 AGTGGCAACCACGGAGGGGGAGG + Intronic
1049212175 8:141391896-141391918 AGGGGCGGCCTCGGGGGCGGCGG + Intergenic
1049396341 8:142402933-142402955 CGGGGCCGCGCCGGTGGGGAGGG - Intronic
1049507835 8:143013338-143013360 AGGGGCCTCCCCTGAGGTTGGGG + Intergenic
1049580360 8:143408075-143408097 AGGGGCGGAGCCGGAAGGGGCGG - Intergenic
1049585007 8:143428980-143429002 AGGGGCCACCCGGGAAGGGACGG + Exonic
1049594830 8:143478425-143478447 AGGGGCGGCCCTGGTGGGTGGGG - Intronic
1050151458 9:2622400-2622422 AGGCGCCACCACGGAGGGGAGGG - Intronic
1050304908 9:4297939-4297961 AGGGGCGGGTCCGGAGGCGGAGG + Intronic
1050356973 9:4792846-4792868 GGGGGCCGCCCCGGTCGGGCGGG + Intronic
1051079690 9:13279657-13279679 CGGGGCTGCCGCGGAGGCGGTGG + Intergenic
1052494689 9:29212328-29212350 AGCGGGCGCCGCGGAGCGGGTGG - Intergenic
1053642929 9:40105797-40105819 AGAGGCTGCTCCGGATGGGGAGG + Intergenic
1053763224 9:41359693-41359715 AGAGGCTGCTCCGGATGGGGAGG - Intergenic
1054489434 9:65762638-65762660 GGGGGCCGCGGCGGTGGGGGGGG - Intergenic
1054541833 9:66270860-66270882 AGAGGCTGCTCCGGATGGGGAGG - Intergenic
1057878228 9:98773890-98773912 AGGGGCCACCCCGTGGGCGGCGG - Exonic
1059234491 9:112750680-112750702 CGCGGCCGCCCGGGAGGGGGCGG - Intergenic
1059455672 9:114398563-114398585 AGGGGGCGGCCCGGGGGGGGCGG + Intergenic
1060268930 9:122127877-122127899 AGGGGTCGCCAGGGAGGAGGCGG - Intergenic
1060945605 9:127568258-127568280 ATGGGGCGCCCCGGAGGCGGTGG - Intronic
1061059529 9:128243565-128243587 AGGGGCCCCCATGGTGGGGGAGG - Intronic
1061208449 9:129177405-129177427 AGGGGCGGCCCCTGGGGGCGCGG + Exonic
1061307030 9:129738059-129738081 CGGGGCAGCCCCGCAGGGAGGGG + Intergenic
1061402972 9:130378419-130378441 AGGGGGAGGCCGGGAGGGGGAGG + Intronic
1061489821 9:130938736-130938758 CGGGGCGGCCCGGGAGCGGGCGG + Exonic
1061666524 9:132163393-132163415 AGGGCCCGCTCCGGAGCGGGGGG + Intronic
1061680710 9:132241310-132241332 TGGGGCCGACCCGGGGGCGGTGG + Intronic
1062411879 9:136429869-136429891 GGGGCCGGCCCCGGAGGAGGGGG + Intronic
1062461167 9:136663116-136663138 AGGGGTGGCCTCGGAGGGGCAGG + Intronic
1062497979 9:136840535-136840557 AGTGGCCGCCCTGGGGCGGGGGG + Exonic
1062532845 9:137009319-137009341 TGGGGCGGGCCCGGGGGGGGCGG - Intronic
1062543917 9:137053469-137053491 TGCCGCCGCCCCGGAGGGTGCGG - Intronic
1202790677 9_KI270719v1_random:88777-88799 AGAGGCTGCTCCGGATGGGGAGG + Intergenic
1203776310 EBV:75162-75184 AGGGGCCGAGGCTGAGGGGGCGG - Intergenic
1203607142 Un_KI270748v1:68209-68231 AGAGGCCGCCGCGGTGGGGTGGG + Intergenic
1186477734 X:9871412-9871434 AGGGGCCGGCCAGGAGGCTGGGG - Intronic
1186669996 X:11758364-11758386 AGGTGCCGCCGCGGAGGGACAGG + Exonic
1189321114 X:40088178-40088200 AGGGGCCCTCCTGGAGTGGGGGG - Intronic
1189332779 X:40153553-40153575 AGGGAGCGCCCCGCGGGGGGTGG - Intronic
1192033871 X:67543958-67543980 GGAGGCCGGCCCGGTGGGGGCGG + Intergenic
1193620686 X:83749951-83749973 GGGGGCCCCCCAGGAGGAGGAGG - Intergenic
1199595872 X:149505332-149505354 AGAACCCGCCCCGGAGGGGAGGG - Intronic
1200111078 X:153741154-153741176 AGGGGCAGCCTGGGAGGGGCAGG + Intronic
1200878982 Y:8191993-8192015 AGGGGAAGCCCTGGAGAGGGTGG - Intergenic