ID: 1147144811

View in Genome Browser
Species Human (GRCh38)
Location 17:38478831-38478853
Sequence GACGCCCACATGACTTTGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 2, 1: 3, 2: 0, 3: 2, 4: 60}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147144811_1147144821 10 Left 1147144811 17:38478831-38478853 CCACACAAAGTCATGTGGGCGTC 0: 2
1: 3
2: 0
3: 2
4: 60
Right 1147144821 17:38478864-38478886 GGTCTCTGCCAAGAGGGCAGTGG 0: 5
1: 0
2: 2
3: 17
4: 307
1147144811_1147144818 3 Left 1147144811 17:38478831-38478853 CCACACAAAGTCATGTGGGCGTC 0: 2
1: 3
2: 0
3: 2
4: 60
Right 1147144818 17:38478857-38478879 GGCCTGGGGTCTCTGCCAAGAGG 0: 5
1: 0
2: 6
3: 25
4: 274
1147144811_1147144823 16 Left 1147144811 17:38478831-38478853 CCACACAAAGTCATGTGGGCGTC 0: 2
1: 3
2: 0
3: 2
4: 60
Right 1147144823 17:38478870-38478892 TGCCAAGAGGGCAGTGGGCCTGG 0: 5
1: 0
2: 2
3: 45
4: 360
1147144811_1147144819 4 Left 1147144811 17:38478831-38478853 CCACACAAAGTCATGTGGGCGTC 0: 2
1: 3
2: 0
3: 2
4: 60
Right 1147144819 17:38478858-38478880 GCCTGGGGTCTCTGCCAAGAGGG 0: 5
1: 0
2: 2
3: 32
4: 240
1147144811_1147144822 11 Left 1147144811 17:38478831-38478853 CCACACAAAGTCATGTGGGCGTC 0: 2
1: 3
2: 0
3: 2
4: 60
Right 1147144822 17:38478865-38478887 GTCTCTGCCAAGAGGGCAGTGGG 0: 5
1: 0
2: 1
3: 18
4: 237
1147144811_1147144824 17 Left 1147144811 17:38478831-38478853 CCACACAAAGTCATGTGGGCGTC 0: 2
1: 3
2: 0
3: 2
4: 60
Right 1147144824 17:38478871-38478893 GCCAAGAGGGCAGTGGGCCTGGG 0: 5
1: 0
2: 3
3: 33
4: 323
1147144811_1147144826 27 Left 1147144811 17:38478831-38478853 CCACACAAAGTCATGTGGGCGTC 0: 2
1: 3
2: 0
3: 2
4: 60
Right 1147144826 17:38478881-38478903 CAGTGGGCCTGGGCCTGCTGTGG 0: 1
1: 4
2: 6
3: 71
4: 493

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147144811 Original CRISPR GACGCCCACATGACTTTGTG TGG (reversed) Intronic
900211771 1:1459722-1459744 GGGGCCCACCCGACTTTGTGTGG + Intronic
900224580 1:1527022-1527044 GGGGCCCACCCGACTTTGTGTGG + Intronic
916141447 1:161702792-161702814 CATGCCCACATGCATTTGTGAGG - Intergenic
918378786 1:183934476-183934498 CACGCCCACATGATGTTTTGTGG - Intronic
1070728614 10:78809203-78809225 GGCGCTCACATGATTTTGAGTGG + Intergenic
1071447774 10:85764619-85764641 AAAGCCCACATGTGTTTGTGAGG - Intronic
1073441653 10:103555896-103555918 GGTGCCCACATGTCTTTGCGGGG - Intronic
1079552785 11:21721131-21721153 GACACCCACATGACTTAGCCAGG + Intergenic
1081413656 11:42788208-42788230 GAGGCCCACAGGTCTGTGTGGGG + Intergenic
1113566089 13:111320564-111320586 GACGCCCACGTGACCTCATGAGG + Intronic
1119087002 14:71748252-71748274 GACTCCCACATGCCTCTCTGTGG - Intergenic
1123856041 15:24412617-24412639 AAGGCCTACATCACTTTGTGTGG + Intergenic
1125658241 15:41375819-41375841 CACTCCCACATACCTTTGTGTGG - Exonic
1128633409 15:69287489-69287511 GACACCCACATCACTGTGTCTGG + Intergenic
1131313076 15:91308246-91308268 GAAGCCCACCAGACTCTGTGGGG + Intergenic
1132777854 16:1605806-1605828 GACTTCCACATATCTTTGTGGGG - Intronic
1136683883 16:31983128-31983150 GACGCCCACATGACTTTGTGTGG - Intergenic
1136784512 16:32926680-32926702 GATGCCCACATGACTTTGTGTGG - Intergenic
1136885271 16:33927126-33927148 GATGCCCACATGACTTTGTGTGG + Intergenic
1137558572 16:49488854-49488876 GAGCCCCTCGTGACTTTGTGTGG - Exonic
1137587615 16:49673218-49673240 GACTCCCAGATGCCTTTGGGAGG + Intronic
1142259854 16:89037595-89037617 GACGGGCACAGGCCTTTGTGAGG + Intergenic
1142262430 16:89049224-89049246 TCCGCCCACATGACCTGGTGGGG + Intergenic
1203087171 16_KI270728v1_random:1190686-1190708 GATGCCCACATGACTTTGTGTGG - Intergenic
1144370996 17:14591712-14591734 GACCCACACTGGACTTTGTGTGG - Intergenic
1145954072 17:28842605-28842627 GAAGGATACATGACTTTGTGGGG - Intronic
1147144811 17:38478831-38478853 GACGCCCACATGACTTTGTGTGG - Intronic
1152531063 17:80919561-80919583 GACGCCCCCGTGTCCTTGTGAGG + Intronic
1159727827 18:71984562-71984584 GACATCCACATCAATTTGTGAGG + Intergenic
1161030587 19:2056211-2056233 GACCCCCACCTGCCTTGGTGGGG + Intergenic
926636005 2:15180619-15180641 GCCCCGCACATCACTTTGTGTGG - Intronic
929766170 2:44845743-44845765 GATGTCCACCTGACTTAGTGTGG + Intergenic
936885003 2:117299865-117299887 GAGGCCCTCATGACTTTGACTGG - Intergenic
1171181192 20:23091927-23091949 GACTCTCACAGGGCTTTGTGAGG + Intergenic
1178427773 21:32492525-32492547 GACATGCACAGGACTTTGTGTGG + Intronic
1180588733 22:16917608-16917630 GTCGCACACATGACTTTATTGGG + Intergenic
1181628827 22:24139801-24139823 GATGCCCACATGAATATTTGTGG + Intronic
952487438 3:33828678-33828700 GAAGACGACATGATTTTGTGTGG - Intronic
954907734 3:54077120-54077142 GCAGCCCACATGATTTTGGGTGG - Intergenic
955644253 3:61119670-61119692 GATGGCCACATGCATTTGTGAGG - Intronic
960579168 3:119259600-119259622 GATGACCACATGGCTGTGTGAGG + Intergenic
966040047 3:175472544-175472566 GATGCCCACAGGACTTTTTGGGG + Intronic
966862004 3:184235790-184235812 GAAGTACACATGACTGTGTGTGG - Intronic
966862024 3:184235936-184235958 GAGGTACACATGACTGTGTGTGG - Intronic
969682049 4:8648788-8648810 GAAGCCCACATGCCTGTGTAGGG - Intergenic
970951261 4:21758395-21758417 GACCCCCACATGTCTCTTTGAGG + Intronic
977665006 4:99636101-99636123 GACGACCACATTACTTTCTGGGG + Intergenic
985468604 5:21844-21866 GACACCCATGTGTCTTTGTGTGG + Intergenic
985726229 5:1517192-1517214 GAGGCCCACAGGACTTGGAGGGG + Intronic
986377866 5:7150710-7150732 GAGGCCAACAGGACATTGTGGGG - Intergenic
986580999 5:9265495-9265517 GACTCCCATGTGGCTTTGTGTGG + Intronic
998565798 5:143214832-143214854 GACGCCCACATGCAGTTCTGGGG - Intronic
999028882 5:148267815-148267837 TCCACCCACATGACTTTGAGTGG - Intergenic
1000234616 5:159345878-159345900 GATCCGCACATGACTTTGAGAGG - Intergenic
1017151679 6:151286435-151286457 GAAGCCCACACGACTTCATGAGG + Intronic
1021724726 7:23537961-23537983 TACTGCCACATGACTTTGGGTGG - Intergenic
1026341137 7:69435004-69435026 GTCTCCTACATGACTTTGTAAGG - Intergenic
1029402914 7:100356691-100356713 GACGGGCCCAGGACTTTGTGCGG + Intronic
1034564697 7:151903968-151903990 GACTTCCACATGTCTTTCTGGGG - Intergenic
1034825415 7:154257860-154257882 CACGGCCACATGACCTTGTTTGG + Intronic
1038012856 8:23488410-23488432 GACGCCCTCAGGGCTTTGTCAGG - Intergenic
1040311915 8:46241161-46241183 GAAGCCCACAGGACTTTTTTGGG + Intergenic
1055160180 9:73117220-73117242 GAACCACAAATGACTTTGTGTGG - Intergenic
1062282103 9:135756767-135756789 GACACACACCTGGCTTTGTGTGG + Intronic
1195077842 X:101344299-101344321 GACACCCACAAGGTTTTGTGGGG + Intergenic
1199550745 X:149058200-149058222 GACCACCAAAAGACTTTGTGGGG - Intergenic
1200017018 X:153173525-153173547 GACTCACCCATGTCTTTGTGTGG - Intergenic