ID: 1147144881

View in Genome Browser
Species Human (GRCh38)
Location 17:38479111-38479133
Sequence CATGGAGGAGGTGCCCCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 453
Summary {0: 5, 1: 0, 2: 2, 3: 42, 4: 404}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147144881_1147144888 1 Left 1147144881 17:38479111-38479133 CCTCCTGGGGCACCTCCTCCATG 0: 5
1: 0
2: 2
3: 42
4: 404
Right 1147144888 17:38479135-38479157 CTGCTCAGTGTCTGCCAGGACGG 0: 1
1: 0
2: 5
3: 35
4: 395
1147144881_1147144889 4 Left 1147144881 17:38479111-38479133 CCTCCTGGGGCACCTCCTCCATG 0: 5
1: 0
2: 2
3: 42
4: 404
Right 1147144889 17:38479138-38479160 CTCAGTGTCTGCCAGGACGGTGG 0: 1
1: 0
2: 0
3: 13
4: 209
1147144881_1147144891 30 Left 1147144881 17:38479111-38479133 CCTCCTGGGGCACCTCCTCCATG 0: 5
1: 0
2: 2
3: 42
4: 404
Right 1147144891 17:38479164-38479186 GTGCTGCATGATTCTGCACCCGG 0: 1
1: 0
2: 0
3: 11
4: 116
1147144881_1147144886 -3 Left 1147144881 17:38479111-38479133 CCTCCTGGGGCACCTCCTCCATG 0: 5
1: 0
2: 2
3: 42
4: 404
Right 1147144886 17:38479131-38479153 ATGCCTGCTCAGTGTCTGCCAGG 0: 1
1: 0
2: 4
3: 27
4: 292

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147144881 Original CRISPR CATGGAGGAGGTGCCCCAGG AGG (reversed) Intronic
900364222 1:2304284-2304306 CAAGGAGGAGGTGACTGAGGAGG - Exonic
900808113 1:4781205-4781227 TGGGGAGGAGGGGCCCCAGGTGG - Intronic
901357847 1:8667319-8667341 CAAAGATGAGGTGCCCCAGGAGG + Intronic
902613198 1:17609122-17609144 CATGCAGGAATGGCCCCAGGTGG - Intronic
902845494 1:19107032-19107054 CATGGCACTGGTGCCCCAGGGGG + Intronic
903296257 1:22345022-22345044 GATGGAGCTGATGCCCCAGGGGG - Intergenic
903775401 1:25790150-25790172 AATGTAGGAGTTGACCCAGGAGG - Intergenic
903875514 1:26471029-26471051 TAGGGAGAAGCTGCCCCAGGAGG + Exonic
904333551 1:29783102-29783124 CATGGAGGAGGTGCTGCTGCAGG - Intergenic
904372493 1:30058743-30058765 CATGGAGGAGGGGCCTGAGCAGG + Intergenic
904456324 1:30650352-30650374 CATGGAGGAGGCCCATCAGGTGG - Intergenic
904563302 1:31413076-31413098 CCTGGGGCAGGTGCGCCAGGAGG - Intronic
904617235 1:31756473-31756495 CGAGGAGGCGGTGGCCCAGGCGG - Exonic
904797541 1:33068539-33068561 TATGGAGGACCTGCACCAGGAGG - Intronic
905250593 1:36645847-36645869 CATCGGGGAGGTAGCCCAGGAGG - Intergenic
905300237 1:36981988-36982010 TGTGGAGGAGGTGCTGCAGGTGG + Intronic
905488612 1:38325995-38326017 CTTGGAGGTGGTGCTGCAGGAGG + Intergenic
905586449 1:39123076-39123098 GATGGAGGTGGTGATCCAGGAGG + Intronic
905613807 1:39379309-39379331 AATGGAGGAGGTTCACAAGGAGG + Exonic
907246062 1:53109934-53109956 CATGGATGGGGTGCCCTGGGAGG - Intronic
907545684 1:55258137-55258159 CAGGGAGGGGGAGCCCCAGCTGG - Intergenic
907848227 1:58228998-58229020 CATGGGTGATCTGCCCCAGGTGG - Intronic
909562981 1:77025782-77025804 CCTGGAGGAGGGGCAGCAGGAGG - Intronic
912501715 1:110127049-110127071 CCTGGACTAGATGCCCCAGGAGG - Intergenic
912703963 1:111898329-111898351 GATGGAGGAGGTAACCCTGGTGG - Intronic
914249816 1:145912441-145912463 TCTGGAGGAGGAGTCCCAGGAGG - Exonic
914456393 1:147841042-147841064 CCTGGAGGAGCTGCCCAAGGAGG + Intergenic
914719967 1:150281823-150281845 GATGGAGGAGCCGCCCCAGCGGG + Intergenic
915238212 1:154501630-154501652 CACGGAGGAGGAGCCCCACCGGG - Exonic
915341246 1:155178019-155178041 CAAGGAGGAGGTGTCGCAGCTGG + Exonic
915635146 1:157181312-157181334 CAGGGAGGATCTGCCCCAGAAGG - Intergenic
916599170 1:166275889-166275911 CATGGCAGAGGTGGCCCTGGTGG - Intergenic
918480771 1:184974503-184974525 CCTGGAGGAGGCGCCCCAGAAGG - Exonic
921046650 1:211482532-211482554 GATGGAGAAGGGGTCCCAGGTGG + Intronic
921207090 1:212858354-212858376 GTTGGAGGTGGGGCCCCAGGAGG + Exonic
921207305 1:212859269-212859291 TATGGATGAACTGCCCCAGGAGG + Intronic
921923286 1:220691056-220691078 CTTGGAGAAGGTGGCCCAGTTGG + Intronic
922428047 1:225517909-225517931 GATGGAGGAGGTGCTGAAGGAGG + Intronic
922775981 1:228214364-228214386 CCTGGAGGATGTGGGCCAGGTGG + Exonic
923046945 1:230362482-230362504 CATGAAGCTGGAGCCCCAGGAGG - Intronic
924043840 1:240009048-240009070 CATGGAGGAGATGGTGCAGGGGG - Intergenic
1064252023 10:13713208-13713230 CAAGGAGGAGGTGGACCAGATGG - Intronic
1069051109 10:63795644-63795666 CTGGGGGGAGGTGCCCCAGAAGG - Intergenic
1069051195 10:63796411-63796433 TTTGGGGGAGGTGACCCAGGAGG + Intergenic
1069898922 10:71695940-71695962 CGTGGGGGAGGTGACCCAGATGG - Intronic
1072033293 10:91541467-91541489 CATGGAGGTGGTGCCACATCAGG - Intergenic
1074904613 10:117850511-117850533 CATGGAGGAGGTGGCGGTGGGGG - Intergenic
1075839989 10:125493586-125493608 CACCAAGGATGTGCCCCAGGAGG + Intergenic
1076212321 10:128658547-128658569 CATGCTCCAGGTGCCCCAGGTGG - Intergenic
1076785660 10:132748687-132748709 CATGGCTGAGCTGCTCCAGGAGG - Intronic
1077372961 11:2192291-2192313 CCTGGAGGGGGTGACCCAGGAGG - Intergenic
1077392106 11:2304909-2304931 CAGGGAGGAGCTGCCCCAGCTGG - Intronic
1077444951 11:2586554-2586576 ACTGGAGTAGGGGCCCCAGGTGG + Intronic
1078360424 11:10663543-10663565 CCTGGAGGAGGTGGCCTTGGAGG - Intronic
1078467986 11:11564453-11564475 CATGGATGAGAAGACCCAGGGGG - Intronic
1078729809 11:13964017-13964039 CAGGGAGGAGGTGTCCAAGCAGG + Intronic
1083026625 11:59556569-59556591 CAAGGAGGAGGCACCCCAAGCGG - Intergenic
1083201130 11:61121666-61121688 CACCGTGGAGGTGCGCCAGGGGG + Exonic
1083412536 11:62504348-62504370 CAGGAGGGAGGAGCCCCAGGTGG - Intronic
1083622527 11:64056217-64056239 CCTGGAGGAGCTGCAGCAGGTGG + Intronic
1083664609 11:64267711-64267733 CAGGAAGGAGGGGCCCCAGGAGG - Intronic
1083762446 11:64826102-64826124 CATGGGGAAGGTGCCACAGAAGG - Intronic
1084527386 11:69705327-69705349 CCTGGATGTGGGGCCCCAGGAGG + Intergenic
1084669589 11:70597214-70597236 CAGGGAGGAGTTTCCCCTGGCGG - Intronic
1084683681 11:70681458-70681480 CTTTGAGGAGATACCCCAGGGGG - Intronic
1084750731 11:71203059-71203081 CATGGAGCAGGTGGCCCTGTGGG + Intronic
1084792683 11:71484530-71484552 CATGGAGACGATGGCCCAGGTGG - Intronic
1084892196 11:72242096-72242118 CATGGAGAAGGTGCCTGGGGAGG - Intronic
1085052310 11:73386223-73386245 TGGGGAGGAGGGGCCCCAGGGGG - Intronic
1089095305 11:115915298-115915320 CATGGTGCAGGGGCCCCAGAAGG - Intergenic
1089401986 11:118169595-118169617 GAGGGAAGAGGTGCCCCAGAAGG + Intronic
1089459359 11:118643740-118643762 CATGGGGGAGGTGGCCAATGGGG + Intronic
1091654990 12:2338746-2338768 CTTGGAGGAGGTGCCCTTGGGGG + Intronic
1092149302 12:6236128-6236150 GAGGGAGGAGGTGCCCTGGGAGG + Intronic
1092650444 12:10629525-10629547 GTTGGAGGATGTGGCCCAGGGGG - Exonic
1096237538 12:49939931-49939953 GCAGGAGGAGGAGCCCCAGGGGG - Intergenic
1097377930 12:58860668-58860690 CCAGTAGGTGGTGCCCCAGGGGG + Intergenic
1099722585 12:86382991-86383013 CCAGGAGGTGGTGCCCCAGTAGG - Intronic
1102212660 12:111138537-111138559 CATGGAGGAGGGAACCCTGGGGG - Intronic
1102532126 12:113554276-113554298 GCTGGAGGAGGGGCCACAGGAGG - Intergenic
1102554632 12:113718975-113718997 CAGGGAGGAGCAGCCCCAGGAGG - Intergenic
1103612073 12:122129997-122130019 CATGGAGGAGGATCCCCTGCTGG + Exonic
1104405171 12:128511002-128511024 CAAGGAGGAGGTCCTCCAGCAGG - Intronic
1104926182 12:132315085-132315107 CCTGACGGAGGTGGCCCAGGGGG + Intronic
1106001034 13:25723745-25723767 CGTGGAGGGAGTGCCCCAGAGGG - Intronic
1107467905 13:40666191-40666213 CATGGCCGAGGCGCCTCAGGTGG - Exonic
1107974020 13:45672099-45672121 CATGGAGAGGTTGCTCCAGGAGG - Intergenic
1109062504 13:57634912-57634934 CATGGGGGAGGTGGCCAGGGAGG - Exonic
1114083709 14:19221437-19221459 CAGGGAGGAGGTCACCCAGCTGG - Intergenic
1114418109 14:22557403-22557425 CCTGGAGGAAGTGCCCAGGGAGG + Intronic
1115351070 14:32396447-32396469 CATGGAGCAGGTGCCTCTGCAGG + Intronic
1117233268 14:53744185-53744207 CATGGAAGGGGAGCCCGAGGAGG - Intergenic
1117791052 14:59342771-59342793 CATGTAGGAGGGGCACCAGCAGG + Intronic
1118262357 14:64259462-64259484 CATGGAGAAGCTGTCACAGGGGG + Intronic
1118593933 14:67421512-67421534 CATTGAGGAGATGGCCCAGAAGG - Intergenic
1119425276 14:74531082-74531104 CAGGGTGGAGATGACCCAGGTGG + Intronic
1119852467 14:77875791-77875813 CATTGAGGAGGAAGCCCAGGAGG + Intronic
1120724616 14:87923825-87923847 GATGGAGGAGGTGACAGAGGAGG + Intronic
1121308762 14:92923615-92923637 CAAGGGGGAGTTGCCCCGGGGGG - Intronic
1121738275 14:96234068-96234090 CGGGGAGGGGGTGCTCCAGGTGG - Intronic
1121990542 14:98552775-98552797 CATGTAAAAGGTGCCCCTGGTGG - Intergenic
1122718348 14:103708277-103708299 CATGGAGCAAGGTCCCCAGGAGG + Intronic
1123056247 14:105572043-105572065 CCTGGAGAAGGGGCCCCAGGCGG + Intergenic
1123057686 14:105579764-105579786 CCTGGAGAAGGGGCCCCAGGCGG - Intergenic
1123080676 14:105692171-105692193 CCTGGAGAAGGGGCCCCAGGCGG + Intergenic
1123081965 14:105699697-105699719 CCTGGAGAAGGGGCCCCAGGCGG - Intergenic
1202895324 14_GL000194v1_random:3206-3228 CAGGGAGGAGGTCACCCAGGTGG - Intergenic
1124346338 15:28923877-28923899 CAGGGATGAGGAGCCCCGGGGGG - Intronic
1124883514 15:33662831-33662853 AAAGGAGGAAGTGACCCAGGTGG + Exonic
1125752115 15:42036364-42036386 CTGGGAGCAGGAGCCCCAGGAGG + Intronic
1125811920 15:42548989-42549011 CATCAAGGGGGTGCCCAAGGTGG + Intronic
1126484974 15:49170136-49170158 CAGGGAGGAGGAGCCAGAGGAGG + Exonic
1128383059 15:67127398-67127420 CCTGGAGGAGGTGCCTGAGGAGG - Intronic
1128515564 15:68339740-68339762 CCAGGAGAAGGTGCCCGAGGTGG - Intronic
1128527270 15:68421174-68421196 CTTGGAGGAGCTTCCTCAGGTGG + Intronic
1128527523 15:68422548-68422570 CTTGGAGGAGCTTCCTCAGGTGG - Intronic
1128725072 15:69982248-69982270 CATGGAGGAGGTGCTCCCCAGGG + Intergenic
1129270620 15:74417558-74417580 GCTGGAGCAGGCGCCCCAGGGGG - Intronic
1129316623 15:74749185-74749207 CCTGGAGGAGGTGCCCCTCCTGG + Intronic
1131442706 15:92470992-92471014 CAAGGAGCAGGCTCCCCAGGAGG - Intergenic
1132556595 16:575373-575395 CCTGGCGGAGGTGCCCCATGGGG + Intronic
1132599722 16:768107-768129 CATGGAGGAGGGGCCAACGGGGG + Intronic
1132618651 16:854319-854341 CCTGGATGTGGGGCCCCAGGTGG + Exonic
1132728703 16:1350109-1350131 CCCGGAGGAGGTGCTGCAGGCGG - Exonic
1134906488 16:17983966-17983988 CTTGGAGCAGATGCCACAGGTGG + Intergenic
1136683956 16:31983408-31983430 CATGGAGGAGGTGCCCCAGGAGG - Intergenic
1136779458 16:32887204-32887226 CTTGGAGGAGGAGCCTCAAGGGG + Intergenic
1136784582 16:32926960-32926982 CATGGAGGAGGTGCCCCAGGAGG - Intergenic
1136885201 16:33926846-33926868 CATGGAGGAGGTGCCCCAGGAGG + Intergenic
1136891158 16:33974314-33974336 CTTGGAGGAGGAGCCTCAAGGGG - Intergenic
1140144805 16:72296187-72296209 CAAGGAGGGGGTGAGCCAGGAGG + Intergenic
1140406722 16:74716452-74716474 CATAGAGGACGTAGCCCAGGAGG + Exonic
1140455777 16:75104824-75104846 CCTGGAGGAGCTGCTGCAGGGGG + Exonic
1140723346 16:77789781-77789803 CCTGGAGAAGTTCCCCCAGGGGG - Intronic
1141138540 16:81482444-81482466 CCTGGAGGAGGAGCTCCTGGAGG + Intronic
1141596252 16:85098600-85098622 CATGGAGGAGGCCCCCGTGGAGG - Exonic
1141728277 16:85805066-85805088 CATGGAGAGGCTGCTCCAGGAGG - Exonic
1142052364 16:87967045-87967067 CCTGAAGGAGGTTTCCCAGGGGG + Intronic
1142117951 16:88369904-88369926 CAGGGAGGTGGGTCCCCAGGAGG - Intergenic
1142133823 16:88442699-88442721 CAGGGAGGAGGCTCCGCAGGAGG + Intergenic
1142320662 16:89380755-89380777 CGTGCAGGAGATGCCCCACGAGG - Intronic
1203081874 16_KI270728v1_random:1149292-1149314 CTTGGAGGAGGAGCCTCAAGGGG + Intergenic
1203087241 16_KI270728v1_random:1190966-1190988 CATGGAGGAGGTGCCCCAGGAGG - Intergenic
1142564383 17:830284-830306 ACTGGAGGAGGAGCCCCACGAGG - Intronic
1143503929 17:7353530-7353552 CCTGGAGGAGGTGCTGCGGGTGG + Exonic
1144639214 17:16928290-16928312 CAGGGAGGGGGTCACCCAGGTGG - Intergenic
1145267193 17:21385565-21385587 ACTGGAGGCAGTGCCCCAGGAGG + Intronic
1145841892 17:28002037-28002059 GATGGAGGAGCTGACCCAGGAGG + Intergenic
1146616323 17:34359873-34359895 CCTGGAGGAGTTGTCCTAGGAGG + Intergenic
1146843703 17:36170943-36170965 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146856010 17:36258877-36258899 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146864610 17:36329498-36329520 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1146871916 17:36382788-36382810 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146879277 17:36433873-36433895 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146883207 17:36455018-36455040 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1147067470 17:37930086-37930108 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1147074802 17:37983412-37983434 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1147079001 17:38009647-38009669 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1147086325 17:38062958-38062980 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1147094938 17:38133582-38133604 GATGAAGGAGTCGCCCCAGGAGG + Intergenic
1147102271 17:38186921-38186943 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1147144881 17:38479111-38479133 CATGGAGGAGGTGCCCCAGGAGG - Intronic
1147547230 17:41411463-41411485 CCTGGAGAAGGTGCGCCAGCTGG - Intergenic
1147548873 17:41424148-41424170 CCTGGAGAAGGTGCGCCAGCTGG - Exonic
1147550856 17:41440546-41440568 CCTGGAGAAGGTGCGCCAGCTGG - Exonic
1148049825 17:44764372-44764394 CATGGACATGGTGCCACAGGGGG + Intronic
1149846859 17:60013428-60013450 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1150085207 17:62270005-62270027 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1150920442 17:69476900-69476922 CATGGATGAGATGGCTCAGGTGG - Intronic
1151384489 17:73746850-73746872 CCTGCAGGAGGTGCCCCCAGGGG - Intergenic
1151886712 17:76926938-76926960 CATGGAGGGGGTGTCCAGGGCGG + Intronic
1152612263 17:81321698-81321720 CATGGCATCGGTGCCCCAGGTGG - Intronic
1152758128 17:82095604-82095626 AATGGAGCAGGCTCCCCAGGAGG + Intronic
1152877318 17:82794238-82794260 CTTGGAGAACATGCCCCAGGGGG + Intronic
1153232093 18:2948161-2948183 CATGGAAGAGCTCCTCCAGGTGG + Intronic
1154330469 18:13425500-13425522 GAGGGAGGAAGTGCCCCAGTAGG - Intronic
1154354883 18:13617008-13617030 CATGGTGCAGGTGTCCCAGCAGG + Intronic
1155994960 18:32321436-32321458 GATAGAGGAGTTCCCCCAGGAGG - Intronic
1159020075 18:63136081-63136103 CAGGGAGGAGGTGCCCCTGAGGG - Intronic
1160015827 18:75139715-75139737 CATGCAGGACGCACCCCAGGCGG + Intergenic
1160028792 18:75241000-75241022 CATGGTGCAGGTACCCCAGCAGG - Intronic
1160220012 18:76968279-76968301 CCTGGAGGAGGTGGTGCAGGAGG + Exonic
1160232421 18:77058320-77058342 CGTGGAGCAGGGGTCCCAGGTGG - Intronic
1160432050 18:78819260-78819282 CAGGGAGGATGAGCCCCTGGAGG + Intergenic
1160519639 18:79497313-79497335 CAAGGAAGAGCGGCCCCAGGGGG + Intronic
1160699411 19:498668-498690 GGAGGAGGAGGAGCCCCAGGGGG + Exonic
1160968193 19:1755780-1755802 GAGGGAGGAGGGTCCCCAGGGGG - Intronic
1160978768 19:1806974-1806996 CATTGGGCAGGTGCCGCAGGTGG - Intronic
1161018136 19:1993507-1993529 CATGGAAAAGGTGCCCAAGAAGG - Intronic
1162017090 19:7851752-7851774 CATGGAGGGGATGTCCCAGGTGG + Exonic
1162026987 19:7900046-7900068 CTTGGAGGAGCTGCACCTGGAGG + Exonic
1162029188 19:7910033-7910055 CATGGAGCAGGTGCCGGTGGAGG - Intronic
1162332444 19:10038602-10038624 CATGAATGAGGAGCCCGAGGTGG - Intergenic
1162573901 19:11487565-11487587 CTTTGAGAACGTGCCCCAGGAGG - Exonic
1162601623 19:11674295-11674317 CAGGGCCGAGGTGCGCCAGGGGG - Intergenic
1162780995 19:13006991-13007013 CATGGGGGATGATCCCCAGGTGG - Intronic
1162932289 19:13963109-13963131 CATGGGCGAGGTGCGCGAGGCGG - Exonic
1162962386 19:14135989-14136011 GATGGATGAGGTTCCCCACGCGG + Intronic
1163386195 19:17001850-17001872 CAGGGAGGGGGTGCCCCCAGGGG + Intronic
1163592615 19:18202988-18203010 CAAGGGGCAGGTGCCCCAGGTGG + Intronic
1163713412 19:18860411-18860433 CAGGTAGGAGGTGCCCGAGCTGG - Exonic
1166118139 19:40668028-40668050 GCTGGAGGAGGTGTCACAGGTGG - Exonic
1166657414 19:44622528-44622550 CAGCGAGGAGGTGACCCAAGAGG - Intronic
1166720839 19:44994861-44994883 CATGGAGCAGGTGGAGCAGGTGG - Intergenic
1166746589 19:45144794-45144816 GATGGCGGAGGAGACCCAGGAGG - Intronic
1167129386 19:47574003-47574025 CACGGAGCAGGGGCCCCAGATGG - Intergenic
1167538013 19:50067791-50067813 CCTGGAGGAGGTGAGCCAAGAGG + Intergenic
1167633608 19:50640273-50640295 CAGGCAGGAGTTGGCCCAGGTGG - Intronic
925041255 2:733169-733191 CATGGAGGGAGGGCGCCAGGCGG + Intergenic
925232166 2:2243081-2243103 AATGAAGGAAGGGCCCCAGGTGG + Intronic
926131339 2:10304542-10304564 CTAGGAGGAGGTGTCCCATGTGG - Intronic
926326907 2:11792878-11792900 CTGGGAGGAGGAGACCCAGGTGG - Intronic
927277555 2:21274475-21274497 CAGGGAAGAGCTGCCCCTGGGGG + Intergenic
927511814 2:23648681-23648703 CATGGAGGACCTGGCCCCGGCGG - Intronic
927916884 2:26942790-26942812 CATGGAGGATGTTCCCCGGCAGG - Intronic
928308768 2:30193115-30193137 CATGGAGGAGGCGCCCGCTGCGG - Intergenic
931632218 2:64311520-64311542 GCTGGAGGAGGTTCCCCTGGCGG - Intergenic
932819362 2:74886512-74886534 CATGGAGGAGATGCGCAACGTGG + Exonic
933141706 2:78799509-78799531 CTTGGAGTAAGTGACCCAGGAGG + Intergenic
933743051 2:85550053-85550075 CCTGGAGCAGCTGGCCCAGGAGG - Exonic
935709089 2:105881596-105881618 CTTGGAGGAGGTGGACGAGGCGG + Exonic
937321488 2:120963627-120963649 CATGGGAGGGGGGCCCCAGGTGG - Intronic
937875558 2:126823009-126823031 CAGGGAGGAGGAGCCCCAGGTGG - Intergenic
937980075 2:127609559-127609581 CATGGCGGAGGAGCCTGAGGAGG + Exonic
938087870 2:128413190-128413212 CAGTGAGGAAGTGCCCCACGTGG + Intergenic
938210001 2:129459307-129459329 CATGGAGGGGGTAGCTCAGGAGG + Intergenic
938492875 2:131775196-131775218 CAGGGAGGAGGTCACCCAGGTGG + Intergenic
938557323 2:132437506-132437528 CACGGAGCAGCTGCCTCAGGAGG - Intronic
939032648 2:137094950-137094972 CTTGGAGCAGGGGCTCCAGGAGG - Exonic
939984122 2:148813729-148813751 CCTGGAGGGGGTGCCCCTGCCGG + Intergenic
940004991 2:149002039-149002061 CATGGAGGAGGAGCCTGTGGAGG + Intronic
940090982 2:149916792-149916814 CATGGGTGAGGTGCCCCAAGTGG - Intergenic
941917649 2:170822860-170822882 CAGGGACGAGGAGCCGCAGGCGG + Intronic
942088428 2:172464209-172464231 CATGCAGCAGGTGCCACCGGAGG - Intronic
943066242 2:183089633-183089655 CATGGAGGTGGTAGCCGAGGTGG + Intronic
943193934 2:184718896-184718918 CAAGCAGGCGGTGCCCCAGTGGG + Intronic
944499161 2:200340568-200340590 CATGGAGGGGGTGCAGCAGGAGG + Intronic
946459724 2:219858130-219858152 CACAGAGGAGCTGACCCAGGGGG - Intergenic
947118286 2:226794785-226794807 CATGTAGGAGCAGCCACAGGAGG - Intronic
947564260 2:231184023-231184045 CATGAAGGAGGTGAGCCAGCTGG + Intergenic
947680427 2:232026537-232026559 CATTGAGGGGGTGCCTCCGGTGG + Intronic
948469317 2:238167140-238167162 CATGGAGGAGGAGGCCCACCCGG + Intronic
948707375 2:239803422-239803444 CATGGAGGAGGTGTCCTTGCAGG - Intergenic
948886308 2:240886866-240886888 CAGGGAGGAGGTGCTCCAAGAGG + Exonic
1171410401 20:24943301-24943323 CAGGGAAGCTGTGCCCCAGGTGG - Intergenic
1172060549 20:32184378-32184400 CTAGGAGGTGGTGCCCCATGTGG - Intergenic
1172092446 20:32443559-32443581 CATGAAGGAGCTGCCCCCAGAGG + Exonic
1172097103 20:32465828-32465850 CCCGGTGGAGGTGCCTCAGGAGG + Intronic
1172178175 20:32985146-32985168 CAAGGAGGAGGTGTTCCTGGGGG - Exonic
1172837495 20:37882429-37882451 CAGGGAGGAGCTGCCCCGAGAGG - Intergenic
1172897302 20:38309470-38309492 CAAGGAGGAGGAGACACAGGTGG - Intronic
1173868588 20:46328437-46328459 AGTGGAGGAGGTGCCCCTGAGGG + Intergenic
1175158209 20:56988474-56988496 CATCGCGGGGGTCCCCCAGGGGG + Intergenic
1175218718 20:57404958-57404980 CATGGTGGAGGTGCCACGAGAGG + Intronic
1175532374 20:59682794-59682816 CAGGGAGGAGGAGCCCGTGGTGG + Intronic
1175760702 20:61560746-61560768 CATGAAGGCAGTGCCCCAGAAGG + Intronic
1175838476 20:62011691-62011713 AATGGAGGCTGAGCCCCAGGGGG - Intronic
1175944840 20:62553835-62553857 CTGGGATGAGGTGACCCAGGGGG + Intronic
1176025518 20:62983370-62983392 CCTGGAGGAGGTGACCCTTGGGG - Intergenic
1176043631 20:63081257-63081279 CAAGGAGGGGGTCCCCCAGGAGG - Intergenic
1176144727 20:63560478-63560500 CCTGGAGGAGGTGGCTGAGGTGG - Exonic
1176615022 21:9019193-9019215 CAGGGAGGAGGTCACCCAGGTGG - Intergenic
1176710179 21:10144678-10144700 TAGGGAGGAGGTCACCCAGGTGG + Intergenic
1176933576 21:14842033-14842055 CCTGGAGGAGGAGCACCTGGCGG - Intergenic
1179437046 21:41369298-41369320 CAGTGAGGAGGGACCCCAGGTGG + Intronic
1179559945 21:42209185-42209207 CATGGAGGAGCTGCCTCTGAGGG + Intronic
1179612834 21:42563547-42563569 TATGGCGGAGGGGCCCCTGGGGG + Intronic
1180000952 21:44995327-44995349 CTGGGAGCAGGTGCCCGAGGCGG - Intergenic
1180086266 21:45509295-45509317 GATGGAGGAGGGGCACCCGGAGG + Intronic
1180115861 21:45704494-45704516 CCTGGCAGAGGCGCCCCAGGGGG + Intronic
1180294266 22:10871830-10871852 CAGGGAGGAGGTCACCCAGCTGG + Intergenic
1180497072 22:15901244-15901266 CAGGGAGGAGGTCACCCAGCTGG + Intergenic
1180782757 22:18529981-18530003 CATGGAGGAGATGGCCAGGGCGG + Exonic
1181126318 22:20704013-20704035 CATGGAGGAGATGGCCAGGGCGG + Intergenic
1181239647 22:21469319-21469341 CATGGAGGAGATGGCCAGGGCGG + Intergenic
1181576802 22:23800507-23800529 CAGGGAGGAGGTCCCCAGGGAGG - Intronic
1182295427 22:29309200-29309222 CACACAGTAGGTGCCCCAGGGGG + Intronic
1182461541 22:30487068-30487090 CAAGGAGGAGGTGACCCTGAAGG - Intergenic
1182480439 22:30605487-30605509 CCTGGAGGAGGTGGCCATGGAGG - Intronic
1183108786 22:35633077-35633099 CTTGGAGAAGGTGCCCCGTGGGG - Intronic
1183378417 22:37478586-37478608 GAGGGAGAGGGTGCCCCAGGAGG + Intronic
1183492620 22:38124734-38124756 GATGCAGGAGGTGCCCAAGAGGG + Intronic
1183653857 22:39173956-39173978 GATGGACAAGATGCCCCAGGGGG - Intergenic
1183742383 22:39675957-39675979 CAGGCAGCAGGTGCCACAGGAGG + Intronic
1184022898 22:41833050-41833072 CCTGGAGGCGGGGCCGCAGGGGG + Intergenic
1184470322 22:44692315-44692337 CTGGGAGGAGGAGCCCCGGGAGG - Intronic
1184470373 22:44692436-44692458 CCCGGTGGAGGAGCCCCAGGAGG - Intronic
1184470427 22:44692577-44692599 CTGGGAGGAGGAGCCCCGGGAGG - Intronic
1184735272 22:46394339-46394361 CATGGAGATGGTTGCCCAGGAGG + Intronic
1184771568 22:46599939-46599961 CAGGGAGAAGGTGCCGCCGGTGG - Intronic
1185014650 22:48335833-48335855 CCAGGAGGAGCTGCCCCAGCAGG - Intergenic
949947544 3:9202458-9202480 TGTGCAGGAGCTGCCCCAGGAGG - Intronic
950128734 3:10527510-10527532 TATTGATGAGGAGCCCCAGGAGG - Intronic
950682427 3:14594336-14594358 TATGGATCAGATGCCCCAGGAGG + Intergenic
953447489 3:42980312-42980334 CATCGAGAATGTGGCCCAGGCGG + Intronic
953877782 3:46676285-46676307 CCTGCAGGAGCTGGCCCAGGAGG - Exonic
954306224 3:49726852-49726874 GAAGGAAGAGGTGCCCCTGGTGG - Exonic
957119246 3:76068432-76068454 TATGGAGAAGGTGCCCTAAGAGG + Intronic
958449768 3:94259149-94259171 AATGAGGGAGGGGCCCCAGGTGG - Intergenic
959950305 3:112174241-112174263 CATGGAGGTGGAGCCCCCAGGGG - Intronic
962203690 3:133418423-133418445 CAAGGAGGAGAAGCCCCGGGAGG + Intronic
962408131 3:135117743-135117765 CTTGCAGGAGATGCCCAAGGTGG + Intronic
962848734 3:139291966-139291988 CATGGAGAAAGGGCCCCAGCTGG - Intronic
968132095 3:196197880-196197902 CATGGAGGTGGAGCATCAGGAGG - Intronic
968689493 4:1983429-1983451 CACGGAGGACCTGCCCAAGGCGG - Exonic
968964913 4:3764979-3765001 CAGGGACGAGGTGATCCAGGAGG - Intergenic
969454654 4:7294494-7294516 CATGGAGGAGGAGCTCCCTGGGG - Intronic
969454662 4:7294517-7294539 CATGGAGGAGGAGCTCCCTGGGG - Intronic
969612757 4:8236361-8236383 CACGCTGGAGGAGCCCCAGGAGG + Exonic
969624710 4:8296613-8296635 CATGTTGGGGGAGCCCCAGGAGG + Intronic
972874937 4:43346914-43346936 GATGGAGGAGGTGGTCCATGAGG + Intergenic
973842383 4:54875463-54875485 CATGGAAGAGGTGACACAGCAGG + Intergenic
979425083 4:120554195-120554217 CATGGAGGCTATGCCCCAGCTGG - Intergenic
980174949 4:129333366-129333388 CATGGAGGCAGTGTCCAAGGTGG - Intergenic
981548522 4:145918863-145918885 CATAGAGGATTTGCACCAGGAGG - Intronic
983883762 4:172959840-172959862 CCTGGAGGAGGTGGGCCTGGAGG + Intronic
983938748 4:173521284-173521306 CATGGAGAAGGTGTCCAGGGTGG + Intergenic
984928223 4:184825535-184825557 CTGGGAGGAGGTGGCCCAGCTGG - Intronic
985763556 5:1764547-1764569 CTTGGAGGAGGAGCCGCAGCCGG + Intergenic
986290512 5:6395820-6395842 CATGGAGGAGCTGAACCAGCAGG + Intergenic
987235619 5:15938538-15938560 CATGGAGGAGGTACACAGGGTGG - Exonic
992195627 5:74336273-74336295 TGTGGAAGAGGTGACCCAGGAGG - Intergenic
994790922 5:104224364-104224386 CATGGAGCGGGAGGCCCAGGTGG + Intergenic
996382541 5:122877002-122877024 CATTGAGGAGGTCCCTGAGGAGG + Intronic
997013320 5:129904352-129904374 CCCGGAGGAGGAGCCGCAGGCGG - Intergenic
997574742 5:134966036-134966058 CTTAGAGCAGCTGCCCCAGGAGG + Exonic
997890109 5:137668500-137668522 CCTAGGGGAGGTGTCCCAGGAGG - Intronic
999199317 5:149804782-149804804 CCTGGGGGAGGTGTCCCAGGTGG + Intronic
999384212 5:151142865-151142887 CCTGGAGGACCTGCCCCTGGTGG - Intronic
1000458840 5:161486727-161486749 CATGGAGGAGGAGACTTAGGAGG - Intronic
1000962031 5:167611421-167611443 CATCCAGGAGGTGCCACAGAAGG + Intronic
1001492049 5:172162829-172162851 GATGGTGGAGGAGGCCCAGGTGG + Intronic
1001580318 5:172793778-172793800 CACGGAGCAGGTGGCCCAGGTGG - Intergenic
1001931953 5:175679402-175679424 CCTGGAGGAGGTGACAGAGGAGG + Intronic
1002494160 5:179600377-179600399 CACGGAGGGAGTTCCCCAGGGGG - Intronic
1002715515 5:181224281-181224303 CATGGAGGAGGAGGTCGAGGAGG + Exonic
1003274352 6:4636712-4636734 CAGGGAGCTGCTGCCCCAGGAGG - Intergenic
1004979597 6:21008410-21008432 CGTGGAGGTGGAGACCCAGGAGG + Intronic
1006453972 6:34121678-34121700 CTAAGAGGTGGTGCCCCAGGAGG - Intronic
1006640484 6:35486820-35486842 CTAGGAGCAGGTGCTCCAGGTGG + Intronic
1006902203 6:37510486-37510508 CCTGGGGGAGGTGCCCAGGGGGG + Intergenic
1007654096 6:43441837-43441859 GATGGAACAGGTGCCCCAGTGGG - Intronic
1013621044 6:111889480-111889502 CAAGGAGGAGGGGCTCCAGCTGG + Intergenic
1015786552 6:136924444-136924466 GATGGAGGAGCTGCCCGGGGAGG + Exonic
1019604535 7:1901875-1901897 TGTGGAGGAGGGGCCCGAGGAGG - Intronic
1019705884 7:2497167-2497189 CATTGATGAAGTGCCCAAGGGGG + Intergenic
1019738816 7:2662920-2662942 CAGGCAGGTGCTGCCCCAGGAGG + Exonic
1019913146 7:4113921-4113943 CGTGGAGGAGGTGTTCCTGGGGG - Intronic
1020097546 7:5377190-5377212 CATGGCAGAGGGGCCCCACGAGG + Intronic
1020281462 7:6652361-6652383 CCTGGCGGAGGTGGCCGAGGAGG + Exonic
1021106632 7:16645825-16645847 CGAGGAGGAGGAGCCGCAGGAGG + Intergenic
1021796818 7:24263825-24263847 CCTGGAGCAGGTGGCCCTGGTGG - Intergenic
1023703139 7:42912046-42912068 GATGCAGGAGGTGCCCGAGGCGG - Exonic
1023876433 7:44288809-44288831 AATGAAGGAGGTGCCCGAGCAGG - Intronic
1025234023 7:57221470-57221492 CATGGAGCTGGAGACCCAGGTGG + Intergenic
1025850256 7:65238842-65238864 AGTGGAGCAGGTGGCCCAGGGGG - Intergenic
1026177934 7:68014168-68014190 CACAGTGGAGCTGCCCCAGGTGG - Intergenic
1026411275 7:70125679-70125701 CGGGTAGGAGGTGACCCAGGTGG - Intronic
1026555737 7:71407289-71407311 CAGGGAGAAGGTGGCCTAGGAGG + Intronic
1028774980 7:94665785-94665807 CAGAGAGGATGTGCCTCAGGTGG - Exonic
1028807312 7:95043448-95043470 CAAGGAGGAAGGGCCCCAGATGG + Intronic
1029443877 7:100602480-100602502 CAGTGAGGAGGGGCCCCAGGAGG - Exonic
1029447308 7:100620968-100620990 AGTGGAGGAGGTGGCCCCGGGGG + Exonic
1032082332 7:128865939-128865961 CATAGAAGAGGTGGCCCAGGAGG + Intronic
1034469525 7:151248023-151248045 CAAGGAGCAGGTGACCCTGGAGG - Intronic
1035326615 7:158070274-158070296 CATGGTGGAGGTGCTCGTGGTGG + Intronic
1035326633 7:158070345-158070367 GGTGGTGGAGGTGCCCCTGGTGG + Intronic
1035326711 7:158070612-158070634 GGTGGTGGAGGTGCCCCTGGTGG + Intronic
1035326735 7:158070684-158070706 GGTGGCGGAGGTGCCCCTGGTGG + Intronic
1035326761 7:158070770-158070792 CATGGTGGAGGTGCCCGTGGTGG + Intronic
1035326820 7:158070967-158070989 CACGGTGGAGGTGCCCGTGGTGG + Intronic
1035326940 7:158071483-158071505 CATGGTGCAGGTGCTCCTGGTGG + Intronic
1035326957 7:158071567-158071589 CCTGGTGGAGGTGCTCCTGGTGG + Intronic
1035326961 7:158071582-158071604 CCTGGTGGAGGTGCTCCTGGTGG + Intronic
1035327024 7:158071880-158071902 CATGGTGGAGGTGCTCCTGGTGG + Intronic
1035327056 7:158072025-158072047 CATGGTGGAGGTGCTCGTGGTGG + Intronic
1035752711 8:2007701-2007723 CATGGAGGAGGTGCTGCTGGTGG - Intergenic
1036064451 8:5363394-5363416 CAAAGATGAGGTGACCCAGGAGG - Intergenic
1037817177 8:22118409-22118431 CCTGGAGGAGATGCTCCCGGAGG - Intronic
1037908811 8:22731219-22731241 GGTGGAGGAGGTGCAACAGGAGG - Intronic
1038408842 8:27342633-27342655 CATGGCAGAGGTGACACAGGGGG - Intronic
1038537655 8:28365346-28365368 AATGGTGGAAGTGCACCAGGTGG - Intronic
1038624289 8:29175736-29175758 CATGGAGGAGGAGCCTCCGCTGG - Intronic
1038761950 8:30392509-30392531 CAGGGTGGATGTGCCCCAGAAGG + Intronic
1039518890 8:38154347-38154369 CATGGGGGAGGAGAGCCAGGAGG + Intergenic
1040081663 8:43291917-43291939 CATTGAGGAGAGGCCGCAGGTGG - Intergenic
1045524458 8:102929958-102929980 CTTGGAGGAGGGGCCCCACGGGG + Intronic
1046808209 8:118503703-118503725 GATGGAGGAAGAGCCCAAGGAGG - Intronic
1047421267 8:124710152-124710174 CATGGGCGAAGTGGCCCAGGTGG + Intronic
1047720710 8:127636455-127636477 CACAGAGGAGGTGCCCAAGAGGG - Intergenic
1048214784 8:132484132-132484154 CATGGAGGAGGGGAAGCAGGTGG - Intergenic
1048738271 8:137525987-137526009 CATTGAGGAGGTGGCTCAGGAGG + Intergenic
1048893136 8:138965559-138965581 ATGGGAGGAGGTACCCCAGGAGG + Intergenic
1049150150 8:141029784-141029806 CATGGATGCGCTGCCCCAGCTGG - Intergenic
1049222116 8:141432955-141432977 GGTGGGGGAGATGCCCCAGGTGG + Intergenic
1049782826 8:144436573-144436595 CATGGAGATGCTGCTCCAGGCGG - Exonic
1051141829 9:13987029-13987051 CACAGAGGAGGAGCCCGAGGTGG + Intergenic
1051364316 9:16310390-16310412 CAGGGAAGAGGGGCCCCAGCTGG - Intergenic
1053647158 9:40130376-40130398 CAGGGAGGAGGTCACCCAGGTGG + Intergenic
1053758567 9:41333467-41333489 CAGGGAGGAGGTCACCCAGGTGG - Intergenic
1054328163 9:63728332-63728354 CAGGGAGGAGGTCAACCAGGTGG + Intergenic
1054537422 9:66245794-66245816 CAGGGAGGAGGTCACCCAGGTGG - Intergenic
1055279732 9:74660669-74660691 CATGGAAGAGCTGCACCAGCTGG + Exonic
1055604508 9:77954519-77954541 CATGGAGGAGGTGACACAGTGGG - Intronic
1056461230 9:86811556-86811578 CCTGAAGGAGGTGACGCAGGAGG - Intergenic
1056512208 9:87316704-87316726 GGTTGAGGAGGAGCCCCAGGAGG + Intergenic
1058736445 9:107898534-107898556 CAAGGAGGAGGTGCCTAATGAGG - Intergenic
1058863805 9:109143389-109143411 AATGGGGGAGGCTCCCCAGGGGG + Intronic
1059340414 9:113594698-113594720 CAGGGAGCAGCTGCCCTAGGGGG + Intronic
1059441332 9:114308709-114308731 GATGGAGAAGGTGACCCAGTTGG - Intronic
1060264416 9:122102181-122102203 CCTGGAGGAAGAGGCCCAGGGGG - Intergenic
1060588525 9:124801635-124801657 CAAGCAGGAGGTGACCGAGGCGG + Exonic
1061392806 9:130327220-130327242 CATGGGGCAGCTCCCCCAGGAGG - Intronic
1061847283 9:133394870-133394892 CATGGTGCAGGGGCCCCAGCAGG - Intronic
1061920231 9:133778621-133778643 CAGGGAGGAGGAGGCACAGGGGG - Intronic
1062112371 9:134789070-134789092 CATGCAGGTGGTCCCCCAGGCGG + Intronic
1062139452 9:134947802-134947824 CCTGCAGGAGGTGCCCCTGCAGG + Intergenic
1062276677 9:135734688-135734710 CATGGAGCAGCCGCCCCGGGTGG + Intronic
1062392292 9:136338669-136338691 CAATGAGCAGGTGCCGCAGGTGG - Exonic
1062474948 9:136722246-136722268 CTTGATGGAGGTGCCCCGGGTGG - Exonic
1062618878 9:137410729-137410751 CATGGAGGAGGTGACCCACGGGG + Intronic
1202794943 9_KI270719v1_random:113673-113695 TAGGGAGGAGGTCACCCAGGTGG + Intergenic
1203774200 EBV:63612-63634 CAAGGTGACGGTGCCCCAGGAGG + Intergenic
1185467329 X:362648-362670 CATGGAGGAGGGGTCCAGGGAGG + Intronic
1185520478 X:734765-734787 CGTGGGGGAGCTGCCCCGGGTGG + Intergenic
1185611964 X:1398402-1398424 CGTGGAGGGAGTCCCCCAGGTGG - Intergenic
1187558126 X:20372600-20372622 CTTGGAGGAGGAGCCCCATGGGG + Intergenic
1188811319 X:34656987-34657009 CATGGAGGAGGTGCGCGTGTCGG - Exonic
1189002074 X:36957933-36957955 CATGGAGGAGGTGCGCGTGTCGG + Intergenic
1190759570 X:53428240-53428262 TATGGAGAAGATACCCCAGGAGG - Intronic
1193254970 X:79337351-79337373 CTTGTAGGAGGCGGCCCAGGAGG - Intergenic
1193643476 X:84039811-84039833 CATGGAGGAGGTTCTCCATGAGG + Intergenic
1200022785 X:153226025-153226047 CATGGAGCAGGTGGGTCAGGGGG + Intergenic
1200047487 X:153410525-153410547 CAGGGAGCAGGGCCCCCAGGGGG - Intergenic
1200089197 X:153626441-153626463 CAGGGAGCAGGGCCCCCAGGGGG + Intergenic
1200100297 X:153686794-153686816 CTTGGAGGAGGAGCCTCAAGGGG - Intronic
1200687116 Y:6266811-6266833 GGTGGAGGTGGTGGCCCAGGAGG + Intergenic
1200829774 Y:7679054-7679076 GATGGAGGTGGTGGCCAAGGAGG + Intergenic
1200886951 Y:8280239-8280261 GATGGAGGTGGTGGCCAAGGAGG + Intergenic
1200988260 Y:9325953-9325975 GATGGAGGTGGTGGCCAAGGAGG + Intergenic
1201011057 Y:9548322-9548344 GGTGGAGGTGGTGGCCCAGGAGG + Intergenic
1201017973 Y:9624389-9624411 GATGGAGGTGGTGACCAAGGAGG + Intergenic
1201048160 Y:9907899-9907921 GGTGGAGGTGGTGGCCCAGGAGG - Intergenic
1201063490 Y:10068893-10068915 GGTGGAGGTGGTGGCCCAGGAGG - Intergenic
1201992627 Y:20043700-20043722 CATGGAGGAGGAGCCAAAGCAGG - Intergenic
1202115864 Y:21468373-21468395 GGTGGAGGTGGTGGCCCAGGAGG + Intergenic
1202119761 Y:21510241-21510263 GATGGAGGTGGTGGCCAAGGAGG - Intergenic
1202122214 Y:21533782-21533804 GATGGAGGTGGTGGCCAAGGAGG - Intronic
1202156793 Y:21895601-21895623 GATGGAGGTGGTGGCCAAGGAGG + Intronic
1202159239 Y:21919142-21919164 GATGGAGGTGGTGGCCAAGGAGG + Intergenic
1202185688 Y:22184057-22184079 GATGGAGGTGGTGGCCAAGGAGG + Intergenic
1202197159 Y:22307723-22307745 GATGGAGGTGGTGGCCAAGGAGG - Intergenic
1202205672 Y:22402339-22402361 GATGGAGGTGGTGGCCAAGGAGG - Intronic