ID: 1147145037

View in Genome Browser
Species Human (GRCh38)
Location 17:38479736-38479758
Sequence CTATGGCTGTGTAGGAAAAA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 4, 1: 0, 2: 2, 3: 17, 4: 200}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147145037_1147145052 25 Left 1147145037 17:38479736-38479758 CCCTTTTTCCTACACAGCCATAG 0: 4
1: 0
2: 2
3: 17
4: 200
Right 1147145052 17:38479784-38479806 CCCAAAGGCTCTCGCGGCCTGGG 0: 5
1: 0
2: 0
3: 6
4: 90
1147145037_1147145046 19 Left 1147145037 17:38479736-38479758 CCCTTTTTCCTACACAGCCATAG 0: 4
1: 0
2: 2
3: 17
4: 200
Right 1147145046 17:38479778-38479800 TCCTCCCCCAAAGGCTCTCGCGG 0: 5
1: 0
2: 0
3: 18
4: 181
1147145037_1147145056 28 Left 1147145037 17:38479736-38479758 CCCTTTTTCCTACACAGCCATAG 0: 4
1: 0
2: 2
3: 17
4: 200
Right 1147145056 17:38479787-38479809 AAAGGCTCTCGCGGCCTGGGGGG 0: 5
1: 0
2: 0
3: 7
4: 62
1147145037_1147145054 26 Left 1147145037 17:38479736-38479758 CCCTTTTTCCTACACAGCCATAG 0: 4
1: 0
2: 2
3: 17
4: 200
Right 1147145054 17:38479785-38479807 CCAAAGGCTCTCGCGGCCTGGGG 0: 5
1: 0
2: 2
3: 3
4: 78
1147145037_1147145050 24 Left 1147145037 17:38479736-38479758 CCCTTTTTCCTACACAGCCATAG 0: 4
1: 0
2: 2
3: 17
4: 200
Right 1147145050 17:38479783-38479805 CCCCAAAGGCTCTCGCGGCCTGG 0: 5
1: 0
2: 0
3: 10
4: 77
1147145037_1147145055 27 Left 1147145037 17:38479736-38479758 CCCTTTTTCCTACACAGCCATAG 0: 4
1: 0
2: 2
3: 17
4: 200
Right 1147145055 17:38479786-38479808 CAAAGGCTCTCGCGGCCTGGGGG 0: 5
1: 0
2: 0
3: 8
4: 62
1147145037_1147145045 10 Left 1147145037 17:38479736-38479758 CCCTTTTTCCTACACAGCCATAG 0: 4
1: 0
2: 2
3: 17
4: 200
Right 1147145045 17:38479769-38479791 AAAGCTGATTCCTCCCCCAAAGG 0: 5
1: 0
2: 1
3: 21
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147145037 Original CRISPR CTATGGCTGTGTAGGAAAAA GGG (reversed) Exonic
900077796 1:832257-832279 CTTTGGCTATGAGGGAAAAAAGG + Intergenic
900962858 1:5936830-5936852 CTGTGGCTTTGTTGGAAACAAGG + Intronic
901800626 1:11706152-11706174 CTATGGCTGTTGAGAAAAACTGG + Intronic
904248847 1:29207943-29207965 TGAGGACTGTGTAGGAAAAAGGG - Intronic
904755349 1:32765806-32765828 CTAGGGCTGTTTAAGAAGAAGGG + Intronic
905652992 1:39668880-39668902 CCATGGCTGTGTAAGAAATATGG + Intronic
905809980 1:40905333-40905355 CCATGGCTATGTAACAAAAAGGG - Intergenic
906091976 1:43187564-43187586 CTAAGGCTGTCTATGATAAATGG - Intronic
908116416 1:60944825-60944847 TTCTGGCTGTGAAGGAAAAATGG - Intronic
910524319 1:88160328-88160350 CTTTGGCTGTCAAGCAAAAAGGG + Intergenic
911053391 1:93691322-93691344 CTGTTGCTGAGTGGGAAAAATGG + Intronic
913376693 1:118160561-118160583 CCATGGCTTTGTAGTAAACAAGG - Intronic
913660683 1:121003882-121003904 CTTTGGATGTGAAGGAAACATGG + Intergenic
914012047 1:143787038-143787060 CTTTGGATGTGAAGGAAACATGG + Intergenic
914165785 1:145174096-145174118 CTTTGGATGTGAAGGAAACATGG - Intergenic
914650677 1:149695698-149695720 CTTTGGATGTGAAGGAAACATGG + Intergenic
915251921 1:154596706-154596728 CTTTAGCTGTGTAGGACAGAAGG - Intronic
917186479 1:172362294-172362316 CTATGAGTGTCTAGGAAAGAGGG + Intronic
918048660 1:180956051-180956073 CTCTGGCTTTGTAGGAAAGAGGG - Intergenic
919053355 1:192538654-192538676 ATATCCCTGTGTAGAAAAAAAGG - Intergenic
920741168 1:208582587-208582609 CTCTGGCCTTGTAGGAAATATGG + Intergenic
920750864 1:208675526-208675548 CTTTGGCTGTGGAGGAACCAAGG - Intergenic
921899896 1:220439122-220439144 GGATGGCTGTGAAGGAAATATGG + Intergenic
922647847 1:227308634-227308656 CTATGTCTCTTTATGAAAAATGG - Intronic
923043411 1:230336576-230336598 CTATGGCTTTGGAAGAAATAGGG - Intronic
924592520 1:245417091-245417113 CACTGGCTGTGTCTGAAAAATGG + Intronic
1065425102 10:25593636-25593658 GTATGCCTCTGCAGGAAAAATGG - Intronic
1066247676 10:33599235-33599257 CTATGGCTGGGTAGACAAAGTGG + Intergenic
1067664237 10:48260406-48260428 CTCAAGCTGGGTAGGAAAAAAGG + Intronic
1068370755 10:56110175-56110197 CTATGTCTGTGTCGGTGAAACGG - Intergenic
1068387638 10:56352232-56352254 ATTTAGCTGTGTAGGAACAATGG - Intergenic
1069893560 10:71666697-71666719 CTATGGGAGGGAAGGAAAAAGGG + Intronic
1070182370 10:74026588-74026610 CAATGGCAGAGAAGGAAAAAGGG + Intronic
1070785748 10:79161260-79161282 CCATGGCTGTGAAGGGAGAAGGG - Intronic
1077878390 11:6326908-6326930 CTATTGCTATGTAAGACAAAGGG - Intergenic
1078197516 11:9148523-9148545 CTAAGTCTGTGCAGTAAAAATGG + Intronic
1078386932 11:10900565-10900587 CTAGCTCTGAGTAGGAAAAAGGG - Intergenic
1078676356 11:13419474-13419496 ATTTGGCTGTGCAGTAAAAATGG + Exonic
1082090054 11:48081646-48081668 CCAGGGCTGTGTAGGAAGACAGG + Intronic
1082777451 11:57258053-57258075 CTAGGGCTGGGCAGGAAGAAGGG + Intergenic
1085372677 11:76024381-76024403 CTCTGGCTGCCAAGGAAAAAAGG - Intronic
1085610703 11:77945970-77945992 CTGTGGCTATGTAGGGAAATGGG - Intronic
1085817696 11:79758025-79758047 CTATGAATGTGTAGAAAGAAAGG - Intergenic
1085835339 11:79950127-79950149 CTATAGTTTTCTAGGAAAAAGGG + Intergenic
1087981884 11:104624520-104624542 CTATTGATGTGTAACAAAAAGGG - Intergenic
1092029441 12:5271979-5272001 CTATGGCTGTTTGGGAAAAATGG - Intergenic
1096603712 12:52749221-52749243 ATTTGGCTGTGCAGTAAAAATGG - Intergenic
1097201814 12:57285292-57285314 CAAAGGCACTGTAGGAAAAATGG + Intronic
1099670861 12:85690018-85690040 TTATGAATGTGTAGAAAAAAAGG - Intergenic
1100961552 12:99968151-99968173 GTTAGGCTGTGTAGGAAAACTGG - Intronic
1103197609 12:119058792-119058814 CAATGGCTCTGAAAGAAAAAGGG - Intronic
1104950712 12:132438715-132438737 CTGTGGCTGTGCAGGAAACAGGG - Intergenic
1105996116 13:25673686-25673708 CTATTGGTGCGTAGGAAAAATGG + Intronic
1108282532 13:48874304-48874326 CTCTGGGTGTGGAGGATAAAGGG - Intergenic
1110870492 13:80447058-80447080 CTATGGCTTTTGAAGAAAAATGG - Intergenic
1111993627 13:95140777-95140799 ATATGGATTTGGAGGAAAAAGGG - Intronic
1112374485 13:98825898-98825920 CTATGGCTGTGGGGGAGAAGGGG + Exonic
1113411725 13:110095898-110095920 ATATGGGGGTGTAGGTAAAAGGG - Intergenic
1113481980 13:110627935-110627957 CCAGGGCTGTGTGGGAACAACGG - Intronic
1116038253 14:39655489-39655511 CCATGGCTCTGAAGGAAGAAAGG - Intergenic
1117229505 14:53701212-53701234 GTATGACTGTGTAAGACAAAAGG + Intergenic
1117609211 14:57464824-57464846 CCCTGGCTGGGGAGGAAAAAGGG + Intergenic
1120012225 14:79429278-79429300 CTATGGTTGAATAGGAAAAGTGG - Intronic
1121454149 14:94027653-94027675 CTATGACTGGGCAGGAAAATGGG + Intronic
1123843559 15:24272732-24272754 CTAGGGCTCTGTGGAAAAAATGG - Intergenic
1123863277 15:24489414-24489436 CTAGGGCTCTGTGGAAAAAATGG - Intergenic
1125796788 15:42409286-42409308 CTGTGGCTGTGGAGGCACAAAGG - Exonic
1127035574 15:54913382-54913404 ATATGGCTCTGTAGTAAAATTGG - Intergenic
1128197208 15:65769327-65769349 TTATGTTTGTGGAGGAAAAAAGG - Intronic
1128493803 15:68178499-68178521 TTATGTCTGAGTAGGAGAAAAGG + Intronic
1129199918 15:73992489-73992511 CTAGGGCTGAGTAGGAGAAGAGG - Intronic
1129761139 15:78130068-78130090 CTTTGGCTGTGAAGGAAAGCAGG - Intronic
1130252372 15:82307893-82307915 CCAAGGCTGCGTAGGAAATAAGG + Intergenic
1130902026 15:88214509-88214531 ATGTGGCTGTGTTGGAAATAGGG - Intronic
1136784735 16:32927594-32927616 CTATGGCTGTGTAGGAAAAAGGG - Intergenic
1136885048 16:33926212-33926234 CTATGGCTGTGTAGGAAAAAGGG + Intergenic
1138365707 16:56474937-56474959 CTGTGGCTGTGAAGGTAAGAGGG + Exonic
1139141094 16:64263621-64263643 CTTTGGCTGTCTAGGAAAAAAGG - Intergenic
1141022341 16:80509054-80509076 CAATGTCTGTGAAGGAAAGAAGG + Intergenic
1203087393 16_KI270728v1_random:1191600-1191622 CTATGGCTGTGTAGGAAAAAGGG - Intergenic
1142908817 17:3069679-3069701 CTCGGGGAGTGTAGGAAAAATGG + Intergenic
1142925750 17:3234564-3234586 CTCGGGGAGTGTAGGAAAAATGG - Intergenic
1143130999 17:4676811-4676833 CCCTGGATGTGGAGGAAAAAAGG + Exonic
1143296137 17:5873383-5873405 CAATGAGTGTTTAGGAAAAATGG - Intronic
1143638541 17:8181510-8181532 CTGTGGGTGAGTGGGAAAAAGGG + Intergenic
1146427402 17:32754683-32754705 CTATGGATGTGAAGGAGCAAGGG + Intronic
1147145037 17:38479736-38479758 CTATGGCTGTGTAGGAAAAAGGG - Exonic
1153938494 18:9953928-9953950 CTATGGCTGGGGACGGAAAAGGG - Intronic
1156554960 18:38056853-38056875 CAATGGATGTGACGGAAAAATGG - Intergenic
1158051120 18:53221322-53221344 CTATGACTGTGTGGGGAAATGGG - Intronic
1158084091 18:53629440-53629462 GTATGACTGTGTATGAAATATGG - Intergenic
1160306130 18:77739009-77739031 CTATGGCTGATTTGGAAAAGTGG + Intergenic
1161686264 19:5704162-5704184 CTGTGGCTGTGAAGGAGGAAGGG + Intronic
1163866271 19:19776132-19776154 CTATAGCAGTTTAGGAAAGAAGG + Intergenic
1164842215 19:31401076-31401098 TTATGGATGTGTAGGAGAGAAGG - Intergenic
1165733606 19:38162238-38162260 CAAAGGCTCTGTAGGAAAACAGG - Exonic
1167750841 19:51379380-51379402 ATATGGATGTGTAGGATAATCGG - Intergenic
929467666 2:42159763-42159785 CTATGGATGTGTAGGGCAGAGGG - Intergenic
929855595 2:45636222-45636244 CTATGGCTGACTATGAGAAAAGG + Intergenic
929957190 2:46467042-46467064 CTTTGCCAGAGTAGGAAAAAAGG - Intronic
933200704 2:79444864-79444886 GAATGGCTGTGTTAGAAAAATGG + Intronic
933522728 2:83393151-83393173 CTATCTCTTTGCAGGAAAAAAGG - Intergenic
933944113 2:87269936-87269958 CTCTGGCTGTGTTCTAAAAATGG - Intergenic
936277785 2:111115684-111115706 CTGTTGCAGTCTAGGAAAAATGG + Intronic
937903779 2:127041775-127041797 CCGTGGCTGTCTAGGAAAAGAGG + Intergenic
938000951 2:127736555-127736577 CTTTGCCTATGTAGGTAAAATGG + Intronic
939350908 2:141036564-141036586 CTTTGCCTTTGGAGGAAAAAGGG - Intronic
939685854 2:145199435-145199457 CTATGCCTATGTAGAAAATAGGG + Intergenic
940407216 2:153318814-153318836 ATATGGCTATGTAGTAAAATGGG + Intergenic
942201805 2:173578644-173578666 CTAGGGCTGTTTAGGGATAAGGG - Intergenic
946593808 2:221282847-221282869 CAAAGTCTGTGGAGGAAAAAAGG - Intergenic
946750195 2:222886825-222886847 CTATGCCTGTGTAGGGGAAGGGG - Intronic
948591245 2:239052180-239052202 TTATTGCTGTTTAAGAAAAATGG - Exonic
1169459995 20:5786203-5786225 CTATGGCTGGTTTGGAGAAAGGG - Intronic
1170173423 20:13440820-13440842 CTATAGTTGAGTAGGAAATATGG + Intronic
1175769800 20:61616482-61616504 CTCTTACTGTGGAGGAAAAAAGG - Intronic
1177507782 21:22040476-22040498 CCATGGCAGTGTTGGCAAAATGG + Intergenic
1178464671 21:32836191-32836213 CTTTGGCTCTGTAGGAAAGTTGG - Intergenic
1178510207 21:33198826-33198848 CTAAGACTGAGAAGGAAAAAGGG + Intergenic
1180119408 21:45736874-45736896 CAGTGGCTGTGGAGGAAACAGGG + Intronic
1181430543 22:22879010-22879032 GTTTGGCTGTGCAGGAAAACTGG - Intronic
1181825861 22:25515048-25515070 CAATGGCTCTGTAGCAGAAATGG - Intergenic
1184822775 22:46923265-46923287 GTGTGGCTGTGTGGGAAGAAAGG - Intronic
949383154 3:3468373-3468395 CAATGGCTGTGTTGCAAATAAGG - Intergenic
953025269 3:39141525-39141547 GTGTGGGTGTGTAGGAAGAAGGG + Intergenic
953574225 3:44100024-44100046 TTATGGTTGTGTAGGTAACAGGG + Intergenic
955067699 3:55546981-55547003 CCAGGGCTGAGTGGGAAAAATGG - Intronic
955940434 3:64142260-64142282 CTCAGGCTGGTTAGGAAAAAAGG + Intronic
957299576 3:78374499-78374521 CTATTTCTGTGTAAGAAATAAGG - Intergenic
960468890 3:118035232-118035254 CTATGGTTGTGAAGTAAAAGAGG - Intergenic
961639696 3:128357518-128357540 GTAGGGCTGTGGAGGAAAAGTGG + Intronic
963667453 3:148206965-148206987 CTATGAGTCTGTAGGAAAAATGG + Intergenic
963902026 3:150742206-150742228 CTATGGCTGTGTCGAAAACAAGG + Exonic
965872971 3:173282195-173282217 CTATGGCTGAGTAGTATAAATGG - Intergenic
965903708 3:173676210-173676232 CTCTGGCTGTTTAGAAAACAAGG - Intronic
966068583 3:175846761-175846783 CTATTTCAGTGAAGGAAAAATGG + Intergenic
967394802 3:188995630-188995652 GTCTAGCTGTGTGGGAAAAAAGG + Intronic
967831360 3:193922746-193922768 CCATGGCTATGGAGTAAAAATGG + Intergenic
968789905 4:2652460-2652482 CTGTGGCTGTGTAGGAAGCATGG + Intronic
968817065 4:2827702-2827724 CTCTGGGTGTGTAGGAAGCAGGG + Intronic
970677394 4:18466755-18466777 CTATTGCTGATTAGAAAAAAAGG + Intergenic
970916682 4:21344030-21344052 GTATGACTGTCTAGGAAAATAGG + Intronic
972881768 4:43433144-43433166 CTATGCATGTGTAGGATAAAGGG + Intergenic
972891112 4:43557471-43557493 CTAAGGCTGTGTAGGAATGCTGG + Intergenic
973830723 4:54756288-54756310 CCCTGGCTGTGTTGGAACAAAGG - Intergenic
976805648 4:89043537-89043559 CTCAGGATGAGTAGGAAAAAAGG + Intronic
978377259 4:108087896-108087918 CTATGGCTGTATAGTGAGAAAGG - Intronic
980422411 4:132580618-132580640 AAATGGCTGTGAAGGACAAAGGG - Intergenic
980834323 4:138172727-138172749 CAATGGTTCTGAAGGAAAAAAGG - Intronic
981124738 4:141092905-141092927 ACATGTCTGAGTAGGAAAAAAGG + Intronic
981978726 4:150765491-150765513 CTATGAGTGTGTAGGGGAAAGGG + Intronic
982334273 4:154215981-154216003 CTATGGCGGAGGAGGAAAAGAGG - Intergenic
982858504 4:160416751-160416773 GTCTGGGTGTGTAGCAAAAATGG - Intergenic
982978639 4:162101967-162101989 ATATGTATATGTAGGAAAAAGGG - Intronic
983783802 4:171706668-171706690 CTATAGTTCTGTAAGAAAAATGG - Intergenic
984583315 4:181534955-181534977 CTATGGCTGTGCAGAAAGAAAGG - Intergenic
986132651 5:4945028-4945050 CTATGACTCTGCAGGAAAAGTGG - Intergenic
987758790 5:22131910-22131932 CCACTGCTGTGTAAGAAAAAGGG - Intronic
988446594 5:31292947-31292969 CTTTTGCTGGGTGGGAAAAAGGG + Intronic
989120534 5:38000163-38000185 CTCTGGCTGTTTATGGAAAAAGG + Intergenic
991893493 5:71365347-71365369 CCACTGCTGTGTAAGAAAAAGGG - Intergenic
993075112 5:83219728-83219750 CTATGACTAAGTATGAAAAAAGG + Intronic
995250058 5:109982985-109983007 CTATAGCTCTGTAGGTGAAAGGG - Intergenic
995947970 5:117672906-117672928 CTTTGGCTGTGAAGGGAAAAGGG - Intergenic
996919020 5:128745649-128745671 CTATGATTGTTTAGGAAAGAAGG + Intronic
999421644 5:151449590-151449612 CAAAGGCGGTGTAAGAAAAAGGG + Intronic
999816218 5:155178964-155178986 GTGTGGCTATGTAGGAAATATGG - Intergenic
999904511 5:156124942-156124964 CTAAGACTGTGTAGCAAGAAAGG + Intronic
1000363933 5:160473521-160473543 ATATGGAGGTGTAGGAAAAACGG - Intergenic
1001197345 5:169685576-169685598 CTCTGCCTTTGTGGGAAAAATGG + Intronic
1004730044 6:18348676-18348698 CTATGGCTGTGGAGAAAGAATGG + Intergenic
1010288451 6:74107615-74107637 AAATGGGTGTGTGGGAAAAAGGG + Intergenic
1013999857 6:116352759-116352781 CTAAGGCTGTGTTGCAAAATGGG - Intronic
1016392747 6:143591627-143591649 CTAGGGCTGTGAAGGCCAAATGG + Intronic
1017798267 6:157867414-157867436 CTGTGGCTGTTTTGGAAGAAAGG - Intronic
1019133510 6:169894163-169894185 CTATGGCTTTGTGGGAAATGGGG + Intergenic
1019576282 7:1739197-1739219 CTCTGGCTGTGGAGGGAGAATGG + Intronic
1020497252 7:8871429-8871451 GTATGGTTGGGGAGGAAAAAAGG + Intergenic
1021275628 7:18647643-18647665 CAATGGCTGAGCAGGGAAAATGG - Intronic
1021339520 7:19446979-19447001 CCAAGGATGTGGAGGAAAAAAGG - Intergenic
1021544186 7:21794824-21794846 AGATGGCTGAGTGGGAAAAATGG + Intronic
1024223855 7:47309989-47310011 CCATGTCTGAGAAGGAAAAATGG - Intronic
1024941507 7:54767920-54767942 CAATGGCTGTGAAGTAAAACAGG - Intergenic
1025171746 7:56764555-56764577 CTGTGGCTATTTAGGAAAATGGG - Intergenic
1028503014 7:91539805-91539827 CTATGGCTATGAGTGAAAAATGG + Intergenic
1028882623 7:95897083-95897105 CTATGGAATTTTAGGAAAAAGGG + Intronic
1032019606 7:128400017-128400039 GTAAGGCTGTGAAGGAACAACGG + Intronic
1032451873 7:132038439-132038461 CTGTGGCTGGGCAGGAAAAGTGG - Intergenic
1033547844 7:142418171-142418193 GTGTGGCTGTGCAGGAAAAGTGG + Intergenic
1033805640 7:144951788-144951810 CTATGCCTGTGTAGCATATATGG - Intergenic
1035304470 7:157922638-157922660 CTTTTGCTGGGAAGGAAAAAGGG + Intronic
1035527827 8:327380-327402 CTTTGGCTATGAGGGAAAAAAGG - Intergenic
1035844656 8:2849746-2849768 CTATGCCAGAGAAGGAAAAATGG - Intergenic
1037060826 8:14507267-14507289 CTATGGGAGTGTAAGAAAGACGG - Intronic
1038566569 8:28623979-28624001 GTATGACTGTCTAGCAAAAAAGG - Intronic
1041794410 8:61731192-61731214 TTATGGATGTGTAGAAAAATAGG - Intergenic
1043828886 8:84963766-84963788 CTATGTATGTGTAGGACTAAGGG + Intergenic
1043849698 8:85202157-85202179 CTTTGGCTGTGAGGCAAAAAAGG + Exonic
1044948591 8:97414328-97414350 ATGTGGCTGGGTAGGAAAGATGG + Intergenic
1047588476 8:126300871-126300893 GGATGGCTTTGGAGGAAAAAAGG - Intergenic
1049886753 9:32407-32429 CGATGGGTGTTTAGGAAAATTGG - Intergenic
1049986013 9:952159-952181 ATATGGCTGTGAATGAAACAAGG - Intronic
1052129252 9:24821782-24821804 CTCTGGCTCTGTAGGAAACTGGG - Intergenic
1052965737 9:34339254-34339276 CAGTGACTGTGTAGCAAAAAGGG + Intronic
1055425368 9:76190065-76190087 CTATGCCTGTGTGGGGAAAACGG - Intronic
1056121222 9:83491259-83491281 CTATGGGTGTGTAAGAAGGAAGG + Intronic
1056152180 9:83802139-83802161 CTAAGGATGTCTAGGAAAAAAGG + Intronic
1061597760 9:131643199-131643221 CTTTGGCTGTGTCAGAACAATGG - Intronic
1188256934 X:27974118-27974140 AAATGCCTGTGAAGGAAAAACGG + Intergenic
1189734421 X:44055009-44055031 CTATGATTGTATAGGAAATAAGG - Intergenic
1190015772 X:46825608-46825630 CTATAGCTTTGTAGGAAATTTGG + Intergenic
1193918337 X:87395499-87395521 GTATGTCTGTGTTGGGAAAATGG + Intergenic
1195284321 X:103368784-103368806 CTATGTATGTGTAAGAAAACTGG + Intergenic
1196101512 X:111852258-111852280 AAATCGCTGTGTAGGAAATATGG + Intronic
1196631401 X:117944242-117944264 TTAAAGCTGTGTAGGGAAAAGGG - Intronic
1197230275 X:123996543-123996565 CTATGGTTGGGGAGGAAAGAAGG - Intronic
1197655725 X:129114110-129114132 ATAGGGCTGTGGAGGAAAAGAGG + Intergenic
1197666339 X:129228025-129228047 ATATGGCTCTTTAGAAAAAATGG - Intergenic
1199336946 X:146629437-146629459 CTGTGGCAGTGTAGGAAACATGG + Intergenic
1199514915 X:148665372-148665394 CTAGAGCTCTGTATGAAAAATGG + Intronic
1200045461 X:153398511-153398533 CTGGGGCTGTGCAGGAAAACTGG + Intergenic
1200749900 Y:6935278-6935300 CAATGGCTGTCTAGGGAAAGGGG - Intronic
1201584823 Y:15548863-15548885 CTTTGGCTGTGTTGGGAAGAGGG + Intergenic