ID: 1147147175

View in Genome Browser
Species Human (GRCh38)
Location 17:38491964-38491986
Sequence CTGGCCCCACTGAGGTTTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 5, 1: 0, 2: 3, 3: 16, 4: 168}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147147165_1147147175 16 Left 1147147165 17:38491925-38491947 CCTGATATCAGGAGGCCCCGGCT 0: 1
1: 4
2: 2
3: 4
4: 111
Right 1147147175 17:38491964-38491986 CTGGCCCCACTGAGGTTTTGGGG 0: 5
1: 0
2: 3
3: 16
4: 168
1147147168_1147147175 -1 Left 1147147168 17:38491942-38491964 CCGGCTCTAGTGACTTTCCCTGC 0: 5
1: 0
2: 0
3: 8
4: 179
Right 1147147175 17:38491964-38491986 CTGGCCCCACTGAGGTTTTGGGG 0: 5
1: 0
2: 3
3: 16
4: 168
1147147166_1147147175 1 Left 1147147166 17:38491940-38491962 CCCCGGCTCTAGTGACTTTCCCT 0: 5
1: 0
2: 1
3: 35
4: 629
Right 1147147175 17:38491964-38491986 CTGGCCCCACTGAGGTTTTGGGG 0: 5
1: 0
2: 3
3: 16
4: 168
1147147161_1147147175 27 Left 1147147161 17:38491914-38491936 CCAAGGTCTGGCCTGATATCAGG 0: 1
1: 4
2: 2
3: 11
4: 154
Right 1147147175 17:38491964-38491986 CTGGCCCCACTGAGGTTTTGGGG 0: 5
1: 0
2: 3
3: 16
4: 168
1147147167_1147147175 0 Left 1147147167 17:38491941-38491963 CCCGGCTCTAGTGACTTTCCCTG 0: 5
1: 0
2: 4
3: 42
4: 497
Right 1147147175 17:38491964-38491986 CTGGCCCCACTGAGGTTTTGGGG 0: 5
1: 0
2: 3
3: 16
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147147175 Original CRISPR CTGGCCCCACTGAGGTTTTG GGG Intronic
900085172 1:889962-889984 TTGACGCCACTGAGGTTTAGGGG - Intergenic
900108086 1:994025-994047 CTGGCCCTGCTCAGCTTTTGGGG - Intergenic
901178843 1:7325766-7325788 GTGGCCCCTCTGAATTTTTGAGG - Intronic
901231227 1:7642600-7642622 CTGGCCCAGCTGAGGCTCTGCGG - Intronic
903127214 1:21256257-21256279 CTGGCCCCACGGGTGTCTTGGGG - Intronic
904748399 1:32725441-32725463 ATGGCTCCCCTGAGGTTTTTCGG - Intergenic
905262568 1:36729992-36730014 CTGGCCCTTCTGAGGCATTGGGG - Intergenic
908257053 1:62311475-62311497 CTGGCCCCATGGTGATTTTGAGG - Intronic
908721388 1:67129825-67129847 TTGGCACTAGTGAGGTTTTGAGG - Intronic
912635986 1:111293781-111293803 CTGGCCCCATTGATGTTTTTGGG - Intronic
916950573 1:169776212-169776234 CTGGCCCCAGTAAGCTTTTAAGG + Intronic
918124692 1:181572717-181572739 GTGGCCCCACTCTGATTTTGTGG + Intronic
920201664 1:204263305-204263327 CTGGCCCCACAGAGGCTCCGGGG - Intronic
920884379 1:209912293-209912315 CTGGCACCACTGCTCTTTTGGGG - Intergenic
923405629 1:233656313-233656335 TTGGCACCAGTAAGGTTTTGAGG + Intronic
923659381 1:235945228-235945250 CTGGCCTCTCTCTGGTTTTGTGG + Intergenic
1065312688 10:24431523-24431545 CTGGAACCACTGAGGTTATGTGG - Intronic
1069598279 10:69686802-69686824 CTGTTCCCACTGAAGTCTTGAGG - Intronic
1070520261 10:77246560-77246582 CTGGCACCATTGATGTATTGGGG - Intronic
1073592367 10:104769337-104769359 CTGTGCCCACGGAGGTGTTGTGG + Intronic
1075446572 10:122517585-122517607 CAGGCCTCGCTGAGGTTGTGTGG + Intergenic
1075831758 10:125417922-125417944 CTGGCCCCCATGAGATTTTTGGG - Intergenic
1077435739 11:2538341-2538363 CTGGCCCCACGGATGTTGTGTGG + Intronic
1086103193 11:83122957-83122979 CTAGTACTACTGAGGTTTTGTGG - Intergenic
1088360231 11:108981622-108981644 ATGGCACCACTGAGATTTGGGGG + Intergenic
1090363599 11:126189328-126189350 CTGGCCCCACTGTGCTGCTGCGG + Intergenic
1092083559 12:5737566-5737588 CTGGCCCCACACAGGCTTGGAGG + Intronic
1093118213 12:15236502-15236524 CCAGCCCCACTGTGATTTTGAGG + Intronic
1096125591 12:49117105-49117127 CTGTGCCCTCTGGGGTTTTGAGG + Intergenic
1096857122 12:54491804-54491826 CTGGCCAAAATGAGGGTTTGGGG - Intergenic
1100875788 12:98960029-98960051 CTGGACCCACCCAGGGTTTGGGG + Intronic
1101377807 12:104185905-104185927 CTGCCTCCAGTGAGGTTTTTAGG - Intergenic
1101677032 12:106926474-106926496 CTGGCCACTTTTAGGTTTTGAGG + Intergenic
1101791646 12:107933260-107933282 CTGTAGCCACTGAGGTTTTGAGG + Intergenic
1102624709 12:114225729-114225751 CTGGCCCCACTGGGGATTTTAGG - Intergenic
1102699302 12:114825315-114825337 CTGGCCCCACTATGTTGTTGAGG - Intergenic
1103036912 12:117664235-117664257 CTGGGCACCCTGAGGTTGTGAGG + Intronic
1107058108 13:36128598-36128620 CTGACCCCACTGAAGGTCTGGGG + Intronic
1108812873 13:54250620-54250642 CTGGCACCAGTGAGGTTGTGTGG + Intergenic
1113827154 13:113265189-113265211 CTGGCCCCACTGGTATTTTGTGG - Intronic
1113949937 13:114066317-114066339 AGGGCCTCACTGAGGGTTTGGGG - Intronic
1114052217 14:18930073-18930095 CTGGCCCAGGTGGGGTTTTGGGG + Intergenic
1114110342 14:19471851-19471873 CTGGCCCAGGTGGGGTTTTGGGG - Intergenic
1120253705 14:82091262-82091284 CTGGCAGCTCTGAGGTCTTGGGG + Intergenic
1122301032 14:100731204-100731226 CTGGCCCCACTGGGGAGCTGGGG + Intronic
1122773432 14:104107045-104107067 CAGGTCTCACTGAGGCTTTGAGG + Intronic
1126564107 15:50076651-50076673 CTGGCTCTAATCAGGTTTTGGGG - Intronic
1131006366 15:88982044-88982066 CTGGCCCCACTTTGTTCTTGAGG - Intergenic
1133141302 16:3746648-3746670 CTGTCCCCAGTGTAGTTTTGGGG - Intronic
1133926821 16:10200003-10200025 CAGGCCCCACTCAGGCTATGAGG + Intergenic
1136686214 16:31996296-31996318 CTGGCCCCACTGAGGTTTTGGGG + Intergenic
1136774243 16:32863128-32863150 CTGGCTTCACAGAGGTATTGAGG + Intergenic
1136786826 16:32939825-32939847 CTGGCCCCACTGAGGTTTTGGGG + Intergenic
1136882946 16:33913965-33913987 CTGGCCCCACTGAGGTTTTGGGG - Intergenic
1136896368 16:33998386-33998408 CTGGCTTCACAGAGGTATTGAGG - Intergenic
1137594768 16:49716250-49716272 CTGACCCCTCTGAGGGTTGGTGG - Intronic
1137857278 16:51807470-51807492 CTGCCCCCACTGAGGGCTTCAGG - Intergenic
1138374215 16:56551572-56551594 CTGGCTCTTCTGAGTTTTTGGGG - Intergenic
1139257599 16:65557829-65557851 CTGGCCCTACTTAGGTCTTAAGG - Intergenic
1141367272 16:83455378-83455400 CTGGCCCACCTGAGGCTCTGGGG + Intronic
1142308964 16:89301031-89301053 CTGGCCTCCCTGGGGTTCTGGGG - Intronic
1203076667 16_KI270728v1_random:1125247-1125269 CTGGCTTCACAGAGGTATTGAGG + Intergenic
1203089062 16_KI270728v1_random:1201495-1201517 CTGGCCCCACTGAGGTTTTGGGG + Intergenic
1144084888 17:11799550-11799572 CTAGCCCGAGTGAGATTTTGTGG - Intronic
1145946058 17:28775506-28775528 CTGGCCACCCTGGGTTTTTGGGG - Intronic
1147147175 17:38491964-38491986 CTGGCCCCACTGAGGTTTTGGGG + Intronic
1152531144 17:80919964-80919986 CTGGGCCCACAGAGGCTGTGCGG + Intronic
1158447844 18:57536641-57536663 CTGTTCCCACTCAGGTTCTGTGG - Intergenic
1158828492 18:61251653-61251675 GTTGCCCCACAGAGGTTCTGTGG - Intergenic
1159993897 18:74942746-74942768 TGGTCCCCACTGAGGCTTTGTGG - Intronic
1160262582 18:77308664-77308686 TTGGCCCCACTGTGTTTTTCTGG - Intergenic
1160686344 19:438669-438691 CTGGCCCCTCTGGGGGTCTGGGG + Intronic
1160831695 19:1107418-1107440 CTGCCCCCACTGGGGGTCTGTGG + Intergenic
1164061666 19:21680691-21680713 CTGGAACAACTGAGGTTTTCTGG + Intergenic
1164888806 19:31805566-31805588 CTGGCACTACTGATATTTTGAGG + Intergenic
927487188 2:23496564-23496586 CTGGCCCCGCTGAAGGTTAGAGG - Intronic
928933184 2:36646420-36646442 CTGGCCCCCTTGTGGTTTGGTGG + Intergenic
929769744 2:44881623-44881645 CTGGATCCACTGGGGTCTTGCGG - Intergenic
931701170 2:64910323-64910345 CTGCCCACAATGAGGTTCTGTGG - Intergenic
932830281 2:74982691-74982713 CTGGCCTCATTGAGGGTGTGGGG + Intergenic
932847127 2:75147301-75147323 ATGTTCCCACTGAGGTTCTGGGG - Intronic
934477300 2:94602196-94602218 CAGGCCCACCTGAAGTTTTGGGG - Intronic
935268033 2:101411305-101411327 GTGGCCCCTCTGAGGCTTGGTGG + Intronic
936953609 2:118002739-118002761 CTGGCCCCTCTCAGGACTTGTGG - Intronic
940555240 2:155217585-155217607 CTGGAGCCACAGAGGTTTAGGGG + Intergenic
942127868 2:172845572-172845594 CTGGCCCCTCTGTGGTACTGGGG + Intronic
944671112 2:201995408-201995430 CTGGCCCACCTGAGCTCTTGGGG - Intergenic
946966407 2:225042161-225042183 CTGGGCCCGCCGAGCTTTTGGGG + Intronic
1171774371 20:29351605-29351627 TTGAACCCACTGAGGTTTGGGGG + Intergenic
1172143766 20:32742732-32742754 CAGGCCCCACTGGGGCTCTGTGG - Intronic
1173498111 20:43533610-43533632 CTGACTCCACTGGGGTTTAGGGG + Intronic
1179273131 21:39866755-39866777 CTGGCCCCACTGTGGTTGTGAGG + Intergenic
1180470689 22:15652446-15652468 CTGGCCCAGGTGGGGTTTTGGGG + Intergenic
1180993766 22:19954254-19954276 CTGGCCCCACTGAGGATACCAGG + Intronic
1182712845 22:32333337-32333359 ATGACCTCAGTGAGGTTTTGAGG + Intergenic
1184066453 22:42124422-42124444 CTGGCCCCACCGACTTTGTGTGG + Intergenic
1184068921 22:42136574-42136596 CTGGCCCCACCGACTTTGTGTGG + Intergenic
1184405920 22:44300788-44300810 CTGGCCCATCTGGGGTTCTGGGG - Intronic
1185097954 22:48821921-48821943 CTGGCCCCACGGAGGCACTGGGG + Intronic
949585839 3:5436009-5436031 CTGGCCCCACTGAGATCTTTAGG + Intergenic
951183716 3:19688337-19688359 CTGGCCTCACAGAGGTCTTTTGG + Intergenic
952856036 3:37771574-37771596 CGGGCCCCAGTGAAGTTCTGTGG - Intronic
954299205 3:49690408-49690430 CTGGCCTCACTGATGTGTAGCGG - Intronic
955579983 3:60408437-60408459 CTTGCCCCACTGGGTTTTAGTGG - Intronic
961936979 3:130594966-130594988 CTGGCCCCACTGTTGATATGTGG + Intronic
963110388 3:141683380-141683402 CTGTCTCCACTGAGGCTGTGAGG + Intergenic
963945010 3:151136053-151136075 CTGTGCCACCTGAGGTTTTGTGG + Intronic
964758980 3:160115454-160115476 CTGGACCCACCCAGGTTCTGGGG + Intergenic
969542662 4:7803451-7803473 CTGGGTCCCCTGTGGTTTTGGGG - Intronic
977299670 4:95253730-95253752 CTGGCAGCACTGGGGTGTTGGGG - Intronic
984105305 4:175538323-175538345 CTGGCTCCACCAAGGATTTGAGG - Intergenic
984535276 4:180967424-180967446 CTGGCCCAAATTATGTTTTGAGG + Intergenic
985383704 4:189422708-189422730 CTACCCCCATTGAGGTTCTGTGG + Intergenic
989736046 5:44708081-44708103 TTGGCACCAGAGAGGTTTTGTGG - Intergenic
992759436 5:79938563-79938585 CTGTGCCCACTGAGGTTTTGTGG - Intergenic
998324657 5:141269199-141269221 CTGTCCTCTCTGAAGTTTTGGGG + Intergenic
999070617 5:148739836-148739858 CTGGAGCTACTGAGGGTTTGTGG - Intergenic
999285470 5:150391873-150391895 CTGGCCCTACTGAAGTGTTCAGG + Intronic
999694922 5:154180261-154180283 CTGGACCCACTGAAGTTTGCTGG + Intronic
1000288489 5:159847835-159847857 CTGGAACCATTGAGGTTCTGTGG + Intergenic
1000451525 5:161394835-161394857 CTGTCCCCACTCATATTTTGAGG + Intronic
1001666637 5:173438593-173438615 TTTGCCTCACTGAGGTTTTGAGG - Intergenic
1002560086 5:180075490-180075512 CGGGCCCCACTGGAGTTCTGGGG - Intergenic
1004807298 6:19217660-19217682 CTAGCACCACTGCAGTTTTGGGG - Intergenic
1005801208 6:29427130-29427152 GTGGCCCAGCTGAGGTTCTGTGG - Exonic
1007403590 6:41618962-41618984 CCAGCCCCACAGAGCTTTTGTGG + Intergenic
1008496225 6:52137035-52137057 CGGCCCCCACTGAGGTGTTTAGG - Intergenic
1009657834 6:66568882-66568904 CTGGGTCAACTGAGGTTTTCTGG - Intergenic
1010639638 6:78308397-78308419 CTGGACCCACTGGGGGTCTGGGG - Intergenic
1010744667 6:79547225-79547247 CAAGGACCACTGAGGTTTTGTGG + Intergenic
1011508428 6:88073522-88073544 CTGGCCCCACTGACATTCAGTGG - Intergenic
1014270308 6:119329033-119329055 CTGGCTGCACAGAGGTTTTCTGG - Intronic
1018450332 6:163901507-163901529 ATGGTGCCACTGAGGCTTTGGGG + Intergenic
1018702556 6:166438600-166438622 CCAGCCCCACTGAGCTTGTGCGG + Intronic
1026661084 7:72303232-72303254 CTGCCCCCACTGTGGTCTTCTGG - Intronic
1026778804 7:73249601-73249623 CTGGCCCCACTTAGTTTTATTGG + Intergenic
1027019666 7:74803009-74803031 CTGGCCCCACTTAGTTTTATTGG + Intronic
1027068360 7:75142932-75142954 CTGGCCCCACTTAGTTTTATTGG - Intronic
1028529853 7:91826626-91826648 GTGGGCCCACTGGGGTTTAGTGG - Intronic
1028888777 7:95963654-95963676 CTAGCACCACTGAGGTTGGGAGG + Intronic
1030069983 7:105689890-105689912 CTGGCCCCACTGAGCTGGTGGGG - Intronic
1032673356 7:134106344-134106366 CTGTGCCCACTAGGGTTTTGGGG + Intergenic
1033450175 7:141455321-141455343 GTGGCCCCAAGGAGGTTCTGAGG - Intronic
1033604779 7:142918973-142918995 CTGGCCACATTGAGCTATTGGGG + Intronic
1034589582 7:152128369-152128391 CAGGCCCCACTGAGTATTCGGGG + Intergenic
1036680626 8:10870273-10870295 CTGGAACCACTGAGTTTTTGAGG - Intergenic
1037046994 8:14318690-14318712 CTGTCTCTTCTGAGGTTTTGAGG - Intronic
1039081087 8:33734621-33734643 TTGGCACCACTGACATTTTGAGG - Intergenic
1039470151 8:37808338-37808360 CTGGCCCCCGTGAGGTTTTAGGG + Intronic
1039597745 8:38806133-38806155 CTGGCCCCAGTGTGGTCGTGTGG + Intronic
1042484522 8:69336075-69336097 GTGGCCCCACTGAGGTCTTCAGG + Intergenic
1042514483 8:69645033-69645055 TTGGCCCCCCTAAGGTGTTGAGG + Intronic
1042664462 8:71190748-71190770 CTGGACCCACTGAATTTTTCAGG + Intergenic
1042956876 8:74260378-74260400 CTGGCCCCAGAGAGGGTTGGAGG + Intronic
1044110517 8:88267413-88267435 CAGGCCCCTTTGGGGTTTTGTGG - Intronic
1045061608 8:98416170-98416192 CTGGCCCCTCTTAAGTTTGGAGG - Intronic
1045718660 8:105079625-105079647 CTGGTTCAACTGAGGTTTTGAGG - Intronic
1048306738 8:133289791-133289813 GCTGCCCCACTGAGGTTTTTGGG - Intronic
1049206318 8:141365296-141365318 CTGGCCCCACTGTGCCTGTGGGG + Intronic
1052153419 9:25150114-25150136 CTGGCCCCACTGAGCTTCTGAGG + Intergenic
1052852670 9:33387366-33387388 CAGGCCCACCTGAAGTTTTGGGG + Intronic
1053680769 9:40483917-40483939 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1053930755 9:43112229-43112251 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054282944 9:63141018-63141040 CAGGCCCACCTGAAGTTTTGGGG - Intergenic
1054293851 9:63319432-63319454 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054391876 9:64623921-64623943 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054503853 9:65892407-65892429 CAGGCCCACCTGAAGTTTTGGGG - Intronic
1056436948 9:86583740-86583762 CTGCCCCCACTGTGGGCTTGAGG - Intergenic
1056759145 9:89402791-89402813 CTGGCCCCACTGTGGGGCTGGGG - Intronic
1056804495 9:89718164-89718186 CTGGCCCCAGGGAAGTGTTGTGG + Intergenic
1057721333 9:97534502-97534524 CTGTCCCCAATTGGGTTTTGGGG - Intronic
1057858889 9:98624324-98624346 CAGGACCCACTGAGGCTGTGAGG - Intronic
1058828143 9:108793305-108793327 CTGGCCACTCAGAGGTTTGGTGG - Intergenic
1061527326 9:131176993-131177015 CTGGCACTACTGACATTTTGGGG - Intronic
1062461343 9:136663773-136663795 TAGGACCCACTGTGGTTTTGGGG - Intronic
1062681484 9:137784338-137784360 GGGGCCCCAATGAGGTTTTGAGG - Intronic
1186342060 X:8655941-8655963 CTTACTCCACTGATGTTTTGAGG - Intronic
1187826385 X:23335684-23335706 CTGGCCCCCCGGAGTGTTTGGGG + Intronic
1188999906 X:36933028-36933050 CGGGCCCAAGTGAGGTTCTGGGG + Intergenic
1189223047 X:39389103-39389125 CTGCCCCAACTGATGCTTTGTGG + Intergenic
1191008825 X:55739423-55739445 CTGTCCCCACTGGGGTTTCAGGG + Intronic
1193246737 X:79238531-79238553 CTGGACCCACTCAGGTCCTGGGG - Intergenic
1197348341 X:125350970-125350992 CTGGACCCACCTGGGTTTTGAGG + Intergenic
1200700822 Y:6400958-6400980 CTTGCCCCACTGTGGTTTCTAGG - Intergenic
1200709198 Y:6468668-6468690 CTGGCCCCACTGTGATTTCTAGG - Intergenic
1200911163 Y:8532583-8532605 CTTGCCCCACTGTGATTTTTAGG + Intergenic
1200929335 Y:8683036-8683058 CTTGCCTCACTGAGATTTTGAGG - Intergenic
1201005666 Y:9507293-9507315 CTTGCCACACTGAGGATTTCAGG + Intergenic
1201024914 Y:9696040-9696062 CTGGCCCCACTGTGATTTCTAGG + Intergenic
1201033290 Y:9763740-9763762 CTTGCCCCACTGTGGTTTCTAGG + Intergenic
1202183173 Y:22156877-22156899 CTGGCCCCACTGTGATTTCTAGG - Intergenic
1202208186 Y:22429524-22429546 CTGGCCCCACTGTGATTTCTAGG + Intergenic