ID: 1147148183

View in Genome Browser
Species Human (GRCh38)
Location 17:38498287-38498309
Sequence GGTCCCTGCCCCAGTGAGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 345
Summary {0: 3, 1: 0, 2: 3, 3: 36, 4: 303}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147148177_1147148183 7 Left 1147148177 17:38498257-38498279 CCTCAAGAGCGCCCGGCTGATGA 0: 1
1: 1
2: 3
3: 1
4: 35
Right 1147148183 17:38498287-38498309 GGTCCCTGCCCCAGTGAGCCCGG 0: 3
1: 0
2: 3
3: 36
4: 303
1147148182_1147148183 -5 Left 1147148182 17:38498269-38498291 CCGGCTGATGAGGGAGACGGTCC 0: 4
1: 0
2: 0
3: 6
4: 80
Right 1147148183 17:38498287-38498309 GGTCCCTGCCCCAGTGAGCCCGG 0: 3
1: 0
2: 3
3: 36
4: 303
1147148181_1147148183 -4 Left 1147148181 17:38498268-38498290 CCCGGCTGATGAGGGAGACGGTC 0: 5
1: 0
2: 0
3: 8
4: 131
Right 1147148183 17:38498287-38498309 GGTCCCTGCCCCAGTGAGCCCGG 0: 3
1: 0
2: 3
3: 36
4: 303

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147148183 Original CRISPR GGTCCCTGCCCCAGTGAGCC CGG Intronic
900105580 1:979480-979502 GGGCCCAGCCCCAATAAGCCAGG - Exonic
900216030 1:1482120-1482142 GGTGGCTGCCCCAGAGAGGCAGG - Exonic
900223149 1:1520123-1520145 GGTGGCTGCCCCAGAGAGGCAGG - Exonic
900229736 1:1550624-1550646 GGTCCCGGGCCCAGGGAGTCAGG + Intronic
900330696 1:2133157-2133179 GGACCCACCCCCAGTGCGCCTGG - Intronic
900420985 1:2555863-2555885 CTTCCCTGCCCCACAGAGCCTGG - Intronic
900653818 1:3745166-3745188 GGTCCCAGGCCCAAGGAGCCTGG - Intergenic
900720536 1:4172941-4172963 GCTCCCCACCCCAGTGAGACTGG + Intergenic
900991223 1:6099250-6099272 GGTCCCTGCCCCTGCCAGCAAGG - Exonic
901188300 1:7388945-7388967 GGGCCCTGCCCCAGTCCGGCAGG - Intronic
902606900 1:17573910-17573932 GGCCCCTGCCCCAGTGAGGCAGG + Intronic
902784500 1:18724272-18724294 GGCCTGTGCCCCAGTGAGCTTGG - Intronic
903007461 1:20308299-20308321 TGTCCCTGGCCCAGGGAGCGGGG - Intronic
903850084 1:26300780-26300802 GGTCCCTGCCACAATCAGCCAGG + Intronic
904256390 1:29257560-29257582 TGTCCCTTCCCCAGAGACCCAGG - Intronic
905207223 1:36349813-36349835 ACTGCCTGCCCCAGTGGGCCAGG - Intronic
905657281 1:39692715-39692737 GGTTCCTCCCCCAGCGAGCCTGG - Intronic
906669299 1:47643128-47643150 GGTCTCTGCCCCAGAGTGCTGGG - Intergenic
907309522 1:53531274-53531296 GGACCCTGCCCCTCTGACCCAGG + Intronic
913372257 1:118113699-118113721 GGTTCATGCCCCAGTTACCCAGG + Intronic
915981331 1:160421771-160421793 GGTCCCTACCCCACTGTGGCAGG - Intronic
917408976 1:174738198-174738220 GGTCCCTGCCACAAGGCGCCTGG + Intronic
920310440 1:205045078-205045100 GGTCTCTGCACCTGTGAGGCAGG - Intronic
920878403 1:209858680-209858702 GGCCCCTGCTCCAGGGCGCCTGG - Intergenic
923208249 1:231778893-231778915 GTTCCCAGCCCCAGTGGGCCGGG + Intronic
923630519 1:235646652-235646674 GGCTCCTTCCCCAGTGAGCACGG + Intronic
923718588 1:236448169-236448191 GGCCCCTGCCCCAGAGATTCTGG + Intronic
924144255 1:241057791-241057813 AGTCCCAGCTACAGTGAGCCGGG + Intronic
1063421013 10:5912515-5912537 GGTCCCTTCCCCAGGGAGACTGG + Intronic
1064147282 10:12835685-12835707 GGTCACCTCCCCAGTGAGCAGGG + Intergenic
1069629661 10:69889884-69889906 GGTTCCTGCCCCACTGGGGCTGG + Intronic
1070569669 10:77631530-77631552 GGTCACTGCCAGTGTGAGCCGGG + Intronic
1071305560 10:84296094-84296116 GGTCTCTGTCCCAGAGAGCCTGG + Intergenic
1072741864 10:97914625-97914647 GGTCCAGGCCCCAGTGACCTTGG - Intronic
1072827850 10:98626534-98626556 GGTCCCTGTCCAAGTGAGTATGG - Intronic
1074157635 10:110812392-110812414 GGCCATTGCCCCAGTCAGCCCGG - Exonic
1074943284 10:118255525-118255547 GGTGCCTGGCACAGCGAGCCCGG + Intergenic
1074954009 10:118369960-118369982 GCTCCCTGCTGCTGTGAGCCAGG - Intergenic
1075795330 10:125116105-125116127 GGTCCCTGCCCCAGGGACTCAGG + Intronic
1076379554 10:130015760-130015782 GGGCCCTATCCCAGTGGGCCTGG + Intergenic
1076426530 10:130371153-130371175 CGTCCCTGCCCCACTGAGTGAGG - Intergenic
1076734148 10:132451235-132451257 GGACCCTCCCCCATTCAGCCAGG - Intergenic
1077005347 11:352674-352696 GGTCTCTGCTCCTGAGAGCCAGG + Intergenic
1077081245 11:725673-725695 GGTCCCAGCCCCGCAGAGCCTGG + Intronic
1077365261 11:2158997-2159019 GGTCTCTGCCCCTGTGGCCCTGG + Intronic
1078069922 11:8101745-8101767 GCTCCCTGGCCCAGCCAGCCAGG + Exonic
1079172877 11:18112897-18112919 GGGCACTGCCCCACTCAGCCAGG + Intronic
1079661625 11:23044168-23044190 GGTCCAGGCTGCAGTGAGCCAGG + Intergenic
1080390898 11:31845522-31845544 GGTCCCAGAGCCAGTGAGCTTGG + Intronic
1081580575 11:44348884-44348906 GGTCAATGCCCCAGTGTTCCTGG + Intergenic
1081597780 11:44471106-44471128 GCCCCGTGCCCCAGTGAGCATGG + Intergenic
1084172214 11:67406119-67406141 GGACCCTGTCCTAGTGACCCAGG + Intronic
1084514808 11:69630996-69631018 GTTCCCTGAGCCAGGGAGCCTGG + Intergenic
1085038140 11:73311692-73311714 GGTCCCTGCCCCAGTGCCAGTGG + Exonic
1089556555 11:119318520-119318542 GGCCCCTGGCCCGGTGGGCCTGG - Intronic
1090365631 11:126203100-126203122 AGTCACTGCCCCAGTCTGCCTGG + Exonic
1090422771 11:126587028-126587050 AGTCCCTGCCTCAGGGAGCTGGG + Intronic
1091622504 12:2100038-2100060 GGTCCATGCCCCTGAGTGCCAGG + Intronic
1091646617 12:2276870-2276892 GGTCCCTGCCCCAGTGATTCAGG - Intronic
1092290370 12:7156751-7156773 GGTCCATGCCCCTCTGAGCCTGG + Intronic
1092938614 12:13386829-13386851 GGTCTCAGCCCCAGAGAGTCTGG + Intronic
1093480787 12:19601844-19601866 GATCCATGCCCCAGTGGGCCTGG + Intronic
1093917912 12:24826141-24826163 GGTCAATGCCACAATGAGCCAGG + Intronic
1095460346 12:42437005-42437027 GGTTCCTGCTCCTGAGAGCCAGG - Intronic
1096495853 12:52038862-52038884 GGTCCCTGGGCCTTTGAGCCAGG - Intronic
1098680580 12:73348594-73348616 GATCTCTGCCCAAGTAAGCCTGG - Intergenic
1099722764 12:86384473-86384495 GATCCCAGCCCCAGTAAGGCAGG + Intronic
1102205444 12:111087541-111087563 AGTAGCTGCTCCAGTGAGCCAGG - Intronic
1102349055 12:112178909-112178931 GGTGCGTGCCCCAAGGAGCCTGG - Exonic
1103882911 12:124180170-124180192 GGCTACTGCCCCAGTGGGCCTGG + Intronic
1104648329 12:130512625-130512647 GGTCCCTGTCCCATTGCTCCTGG + Intronic
1104785121 12:131444166-131444188 GGTCTCTGCCCACGTGAGGCTGG - Intergenic
1104890774 12:132139116-132139138 GGTCTCTGCGCCAGGCAGCCCGG - Exonic
1105472637 13:20706091-20706113 GGGCTCTGCCACAGTGAGCTTGG - Intronic
1105702510 13:22943901-22943923 GATCCCTGCCACAGTGATTCAGG + Intergenic
1105855138 13:24365682-24365704 GATCCCTGCCACAGTGATTCAGG + Intergenic
1112415362 13:99200170-99200192 GGTCCCCGGCCCGGCGAGCCCGG - Intergenic
1113380002 13:109795656-109795678 CGTCCCTTCCCCAGGAAGCCAGG - Intergenic
1116757206 14:48962975-48962997 GGCCCCTGCCCATGTCAGCCGGG + Intergenic
1117013494 14:51494488-51494510 AGTCTCTGCCCCAGTGTGCCTGG - Intronic
1117297424 14:54393010-54393032 GCTCCCTGCTCCAGGGAGCCCGG - Intergenic
1117902521 14:60550501-60550523 GGCCCCAATCCCAGTGAGCCAGG - Intergenic
1118639879 14:67782467-67782489 GGTCCCTTCCCCAGAGGCCCAGG - Intronic
1119474061 14:74917086-74917108 GGGACCTGCCCCAGGGACCCAGG + Intronic
1122285449 14:100649077-100649099 GATCCCCACCCCAGTGAGTCTGG + Intergenic
1122827389 14:104376882-104376904 GGTCTCAGGCCCAGTGACCCGGG + Intergenic
1122902175 14:104786474-104786496 GGGCCCTGCCCAAGAGAGACGGG - Intronic
1122938547 14:104970953-104970975 GGTCACTGGCCCAGTGACCATGG - Intronic
1125335892 15:38625981-38626003 TGTCCCTGTCCCAGCGAGGCTGG + Intergenic
1125680687 15:41528328-41528350 TGTCCCTGCCCCAGAGAGCGGGG - Exonic
1127092444 15:55480366-55480388 GGTCCCTGCTACAGTGGCCCTGG - Intronic
1127583296 15:60357226-60357248 GTTCCCAGCCCCTGTGAACCAGG + Exonic
1127811345 15:62568167-62568189 GGTCCTTGTCCCAGTGTGGCTGG + Intronic
1128655979 15:69462388-69462410 GGTCTCGGCCCCAGGGAGCCTGG + Intergenic
1129655898 15:77525680-77525702 GGTCCTGGGACCAGTGAGCCAGG - Intergenic
1129666014 15:77579741-77579763 TTTCCCAGCCCCAGTGAGCCTGG - Intergenic
1129676573 15:77634996-77635018 GCTCCCTGCCTCAGTGATCTCGG + Intronic
1130234341 15:82120403-82120425 AGTCTTTGCCCCACTGAGCCCGG - Intergenic
1131111415 15:89767299-89767321 GGTCCCAGCCCCAGGGGGCCAGG - Intronic
1132043556 15:98546042-98546064 GTGCTCTGCCCCACTGAGCCTGG - Intergenic
1132117689 15:99149563-99149585 GGCCCCTGCCCCAGAGACTCTGG + Intronic
1132129510 15:99262710-99262732 GGTCACGGCTGCAGTGAGCCAGG - Intronic
1132184534 15:99792034-99792056 GGTCCCAGCCCCAGTGACTAGGG + Intergenic
1132389534 15:101428257-101428279 GGTGCCTGCCCCAGTGCCCGTGG + Intronic
1132414812 15:101612569-101612591 AGTCCCTGCCCCGGGGAGCAGGG - Intergenic
1132432442 15:101772625-101772647 GGTCCCAGCCCCAGTGACTGGGG - Intergenic
1132623631 16:879807-879829 GGTCCCTGGCCCCCTGACCCCGG + Intronic
1132639536 16:971262-971284 CGTGCCTGCCCCAGTGAGCTCGG - Intronic
1132940159 16:2502376-2502398 GGTACCTGCCTCTGTGACCCAGG - Exonic
1133277125 16:4645782-4645804 GGGACCTGCCCCAGTGTGGCTGG + Intronic
1133975308 16:10596167-10596189 AGTCCCAGCCCCAGGGAACCAGG - Intergenic
1135929932 16:26727859-26727881 CGTCCCTGCCCAAGGGAACCAGG - Intergenic
1136522510 16:30805974-30805996 GGTCCTTCCCCCAGGGAGCTCGG - Intergenic
1136687205 16:32002618-32002640 GGTCCCTGCCCCAGTGAGCCCGG + Intergenic
1136787818 16:32946169-32946191 GGTCCCTGCCCCAGTGAGCCCGG + Intergenic
1137559808 16:49495291-49495313 TGTCCCTGGCCCCGTGTGCCAGG - Intronic
1138350164 16:56342132-56342154 GGATCCTGCCCTAGTGACCCGGG + Intronic
1138648936 16:58446221-58446243 GGTCGATGCTGCAGTGAGCCAGG + Intergenic
1139471362 16:67179700-67179722 TGCCCCTGCCCCAGTGAGGTGGG - Intronic
1139964055 16:70735789-70735811 GGTCCCTGCCTGAATCAGCCTGG + Intronic
1140111741 16:72010795-72010817 GGTCCAGGCTGCAGTGAGCCGGG - Intronic
1141684707 16:85563645-85563667 GCTCCCTCCCACAGTGAGACAGG + Intergenic
1142155232 16:88529975-88529997 AGCCACTGCCCCAGGGAGCCAGG + Intronic
1142187016 16:88699413-88699435 TGTCCCTACCCCAGGGGGCCTGG + Intronic
1143411012 17:6708804-6708826 GGTCCCTGTCTGAGTGAGCGTGG - Intronic
1144357081 17:14456463-14456485 GCTCTCTGCTCCAGTCAGCCCGG + Intergenic
1144737156 17:17561595-17561617 GGCCCTTGCAACAGTGAGCCAGG + Intronic
1144952315 17:19000877-19000899 GGGCCCTGCCCCTGTGAGCCTGG + Intronic
1147148183 17:38498287-38498309 GGTCCCTGCCCCAGTGAGCCCGG + Intronic
1148091009 17:45022415-45022437 CTTCCCTGACCCAGTGAGCTGGG - Intergenic
1148863696 17:50617916-50617938 AGGCCCTGCCCCAGGTAGCCGGG + Exonic
1149355921 17:55839470-55839492 GGTCCCAACCCCATGGAGCCTGG + Intronic
1149505475 17:57190424-57190446 AGTCTCTGCCCCAGTGACCAGGG + Intergenic
1149554754 17:57565444-57565466 CGTCCCTGCCCCTTTGTGCCTGG + Intronic
1150285240 17:63950440-63950462 GGCCCCGGCCCCGGGGAGCCTGG + Intronic
1150631675 17:66884700-66884722 GGGCACTGCCCCACTGAGCCGGG + Intronic
1150655815 17:67038670-67038692 TGTCCCTACCCTAGTGGGCCAGG + Intergenic
1151233046 17:72698714-72698736 AGTCCCTGCCCCAGTGGAACTGG + Intronic
1151457092 17:74232691-74232713 GGTTCCTCCTCCAGTGATCCTGG - Intronic
1151465444 17:74282004-74282026 GGTCCCTGCCCCAAGGGCCCTGG + Intronic
1151768844 17:76146515-76146537 CTTCCCTACCCCAGGGAGCCAGG - Intronic
1151802199 17:76385058-76385080 GATCCCTGCCCCAGCCATCCAGG - Exonic
1151945715 17:77318841-77318863 AATCCCTGCCCCACAGAGCCAGG - Intronic
1152068009 17:78121987-78122009 GGCCCCTGCCCCAGCGGGCAGGG - Intronic
1152104974 17:78323499-78323521 GGGCCCTGCCACAGGCAGCCAGG + Intergenic
1152564087 17:81092449-81092471 AGGCCCTGCCCCAGAGAGGCAGG + Intronic
1152937771 17:83150462-83150484 GGCCCCTGCTCCTGGGAGCCTGG - Intergenic
1155142440 18:23055237-23055259 GGTGCTTGTCCCAGGGAGCCAGG - Intergenic
1156165423 18:34414375-34414397 GGTCTCTGCCCCTGTGATCAAGG + Intergenic
1156457378 18:37302386-37302408 GGTGCCTGCCCCAATGATCAGGG - Intronic
1156502315 18:37567343-37567365 GATGCCAGCCCCAGTGGGCCTGG - Intergenic
1157204784 18:45688821-45688843 AGTCCCTGCACCATGGAGCCTGG - Intergenic
1157452374 18:47798578-47798600 GGTCACTGCCACAGTGTCCCAGG - Intergenic
1157493258 18:48138373-48138395 GGAGCCTGCCCCAGAGAGGCAGG + Intronic
1160730506 19:639808-639830 CGTCCCCGCCCCAGCGAACCCGG + Intergenic
1160943359 19:1630221-1630243 GGCCCCTGCACCTGGGAGCCTGG - Intronic
1161307139 19:3574327-3574349 GAGCCCTGCCCCAGTACGCCAGG + Intronic
1162033547 19:7927374-7927396 GGCTCCTGCCCCACAGAGCCTGG - Intronic
1162372309 19:10286970-10286992 GGGCCCCGCGCCAGAGAGCCAGG - Exonic
1162505801 19:11084139-11084161 GGTCTCTGCCCCAACGAGCCTGG - Intergenic
1162676257 19:12300559-12300581 GGTCAAGGCCGCAGTGAGCCAGG - Intergenic
1162808234 19:13150056-13150078 GGTGCCGGCCCCAGCGTGCCCGG - Intronic
1163184666 19:15629129-15629151 GATCCCGGCCCCACTGCGCCAGG - Intronic
1165854180 19:38870095-38870117 GGTCCCGGCCCCTGTGCCCCCGG + Exonic
1166377344 19:42335041-42335063 GGACCATGCCGCTGTGAGCCTGG + Exonic
1166539246 19:43594712-43594734 GATCCCTCCCCCAGTGAGTTTGG - Intronic
1167079193 19:47267646-47267668 TTTCCCCGCCCCAGTGAGGCGGG - Intronic
1167128666 19:47569808-47569830 GGTCGAGGCTCCAGTGAGCCAGG + Intergenic
1167307892 19:48719590-48719612 AGTCCCTTCCCCAGAGAACCTGG - Intronic
925305142 2:2842839-2842861 GATCCAAGCCCCATTGAGCCCGG + Intergenic
925351424 2:3203685-3203707 AGTCCCTGCCCCAGAGCGGCTGG + Intronic
926584725 2:14673547-14673569 GGTGCCTGCCCCAGTGATTGGGG - Intergenic
927382737 2:22498014-22498036 GTCCCCTGCCCCTGTGAACCAGG + Intergenic
928176500 2:29037611-29037633 TGTCCCAGCCCCAGGGAGCTGGG - Intronic
929455353 2:42061175-42061197 GGGCACTGACCCAGAGAGCCGGG - Intergenic
929550904 2:42891208-42891230 GGTCCCTACCCCAGTGAAGGGGG - Intergenic
929765830 2:44843475-44843497 GGATCCGGCCACAGTGAGCCGGG - Intergenic
932361658 2:71113330-71113352 GGTTCTTGCCCTACTGAGCCAGG - Intronic
932403108 2:71495784-71495806 AGCCCCTGCCCCAGTGACTCCGG - Intronic
932574663 2:72956082-72956104 GCTCTCTGCCCCATGGAGCCTGG - Intronic
934056066 2:88252701-88252723 GGACCCTTCCCCAGTGGCCCTGG + Intergenic
934775476 2:96934422-96934444 GGTCCTTGCCCCAGTCTTCCAGG - Intronic
935935578 2:108179066-108179088 GCTCCCTACCCCTGTGATCCTGG + Intergenic
936020158 2:108988590-108988612 CCTGCCTTCCCCAGTGAGCCGGG + Intronic
936152679 2:110030238-110030260 GGTCCCTGCCAGGGTGCGCCTGG - Intergenic
936285344 2:111177109-111177131 TGTCCCTGCCCCAGCCAGCAAGG + Intergenic
937145159 2:119638430-119638452 GGTCACTCTGCCAGTGAGCCTGG - Intronic
937313440 2:120916127-120916149 AGCTCCTGCCTCAGTGAGCCTGG - Intronic
937799727 2:126069167-126069189 GGCTCCTGCCCCAGCGAGGCTGG - Intergenic
938313158 2:130307901-130307923 GGTTCCTGCCCCACTGAGGCTGG + Intergenic
942346317 2:175005740-175005762 GGCTCCAGCCACAGTGAGCCTGG - Intergenic
943822587 2:192345379-192345401 GCTTCCTGCTCCAGTAAGCCAGG + Intergenic
945116953 2:206417315-206417337 GGAGTCTGCCACAGTGAGCCAGG - Intergenic
946766358 2:223044592-223044614 GGTTCCTGCCCAAGGCAGCCAGG - Intergenic
947075382 2:226338190-226338212 GTTCCCTTCCCTAGTGAGACAGG - Intergenic
947461177 2:230306143-230306165 GGTCCCTGCCTCAGGGACACAGG - Intronic
948176824 2:235950163-235950185 GGTTACGGCCCCAGTGATCCTGG + Intronic
948458077 2:238116489-238116511 GGCCCCTGCCCCAGGGACTCAGG - Intronic
948902354 2:240963055-240963077 TGACCCTGGCCCAGTGACCCCGG - Intronic
1169217819 20:3803589-3803611 GGTGCCAGCACCTGTGAGCCTGG - Intronic
1170567867 20:17616890-17616912 GGTCCCTGCAGGAGTGAGCATGG - Intronic
1171180711 20:23088618-23088640 GATCCCTGCCTCTGTGATCCTGG + Intergenic
1172848524 20:37944501-37944523 GGTCCCTGCCCCAGTGTTCAGGG - Exonic
1172873262 20:38148721-38148743 GGGCCCTGGGGCAGTGAGCCTGG - Intronic
1172882833 20:38212990-38213012 GGGCCCTGGCCCAGTGCTCCTGG + Exonic
1172931805 20:38591725-38591747 GGTCCCTGCGCCCCTCAGCCTGG - Intergenic
1172971189 20:38874093-38874115 GTTCCCTCCCCCAGTGAACAGGG - Intronic
1173877286 20:46381990-46382012 GGTACCTGCCCCAGGGAGTGTGG - Intronic
1174107806 20:48175380-48175402 GGGCTCTGTCCCAGGGAGCCCGG + Intergenic
1175732848 20:61365774-61365796 AGGCCATGCCCCAGTGAGCTTGG - Intronic
1175934303 20:62508053-62508075 GCTCCCTGCCCCAGGGGCCCTGG + Intergenic
1176037801 20:63048875-63048897 TGGCCCTGCCCCACTGACCCAGG + Intergenic
1176097702 20:63351936-63351958 GGCTGCTGCCCCCGTGAGCCTGG - Intronic
1176174093 20:63709745-63709767 GGTCCAGGCTGCAGTGAGCCAGG - Intronic
1178487846 21:33030160-33030182 GGTGCCTGCCTGTGTGAGCCAGG - Intergenic
1179888907 21:44326101-44326123 AGGCCCTGCCCCAGGGAGCCAGG - Intronic
1179894693 21:44354935-44354957 GGTCCCTGCACCTGCGAGGCAGG - Intronic
1180175493 21:46085177-46085199 GGACCCTGCCCCTGTGACCGAGG + Intergenic
1180175506 21:46085237-46085259 GGACCCTGCCCCTGTGACCGAGG + Intergenic
1180175521 21:46085305-46085327 GGACCCTGCCCCTGTGACCGAGG + Intergenic
1180175550 21:46085433-46085455 GGACCCTGCCCCTGTGACCGAGG + Intergenic
1180226363 21:46394958-46394980 GCACCCTGCCCCAGTGCCCCTGG + Intronic
1180784051 22:18537095-18537117 GGCCCCGGCCCCAGGGAGCTGGG - Intergenic
1181127620 22:20711143-20711165 GGCCCCGGCCCCAGGGAGCTAGG - Intronic
1181240952 22:21476447-21476469 GGCCCCGGCCCCAGGGAGCTGGG - Intergenic
1182245702 22:28955848-28955870 GGTCCGGGCTGCAGTGAGCCAGG + Intronic
1182841779 22:33396666-33396688 CGTCCCTGCCCGAGAGAGCTTGG + Intronic
1183376427 22:37468009-37468031 GGGCCCTGATCCAGGGAGCCAGG - Intergenic
1183395328 22:37568179-37568201 GGTTCCTTCCCCTCTGAGCCCGG + Exonic
1183491789 22:38120730-38120752 GGCCACGGCCCCAGTGCGCCAGG + Intronic
1184060298 22:42077470-42077492 GGGCCGGGCCCCACTGAGCCTGG + Exonic
1184186821 22:42870309-42870331 GGCCCCAGGCCCACTGAGCCCGG + Exonic
1184478530 22:44734613-44734635 GCTCCCTGCCCCATGGGGCCAGG - Intronic
1184751562 22:46489275-46489297 TCTCCCTGCCCCACTGAGCCAGG - Intronic
1184880420 22:47300842-47300864 GGCCCCTTCCCCGGTGAGGCTGG - Intergenic
1185063151 22:48617517-48617539 CGTCCCTGCCTCAGTGGCCCCGG + Intronic
1185299509 22:50072214-50072236 GGCCCCTGCCCTAGAGGGCCAGG + Intronic
949907584 3:8871626-8871648 GGTTCCAGCCCCACTGAGCAAGG - Intronic
950221826 3:11201960-11201982 GGTGCCTGCCCCGGTGAGGGGGG - Intronic
953101165 3:39829635-39829657 GGCCCCAACCCCATTGAGCCAGG - Intronic
954388975 3:50259135-50259157 GGGCCCTGCCCCAGCGGCCCTGG + Exonic
954801528 3:53189754-53189776 TGCCCCAGCCCCAGTCAGCCTGG - Intronic
956231095 3:67017538-67017560 GGGGCCTGCCCCAGTGAGTGGGG + Intergenic
956645747 3:71454112-71454134 TGTCCCTTCTCCAGTGACCCTGG + Intronic
957292205 3:78292381-78292403 GGTCCCAGCCTGAGTGAGCATGG - Intergenic
961065185 3:123869406-123869428 GGTTCCTATCCCAGTGAACCTGG + Intronic
966665434 3:182465801-182465823 GGTCTATGCCCAAGTGCGCCTGG + Intergenic
968614658 4:1571994-1572016 GGTCCCTGGCCCACTCTGCCTGG + Intergenic
968902502 4:3438251-3438273 GCTCCCTTCCTCAGTGAGCCTGG - Intronic
969315129 4:6377325-6377347 GGTCACTGCCCAAGGGAGGCAGG + Intronic
969704997 4:8786845-8786867 GGTTCCTGCACCAGAGGGCCAGG - Intergenic
969856508 4:10004018-10004040 GGACTCAGCCCCAGTGAGCAGGG + Intronic
971943208 4:33241503-33241525 GGTCCCACCCCCACAGAGCCTGG - Intergenic
972502252 4:39689317-39689339 GGTCTAGGCCACAGTGAGCCAGG - Intergenic
979942522 4:126779722-126779744 GGGCCCCGCCCCAGACAGCCAGG + Intergenic
980963855 4:139501862-139501884 AGCCCCTGCCCCAGGAAGCCTGG - Intronic
981403581 4:144341634-144341656 GGACCCTAACCCAGTGATCCAGG + Intergenic
981549898 4:145933359-145933381 GGTCCCTGCCACAGTTAGTCAGG + Intronic
984359681 4:178712028-178712050 GGGACCTGCCCCTGTCAGCCTGG + Intergenic
985226426 4:187765896-187765918 GTTCCCTGCCTCAGTTACCCGGG - Intergenic
985759866 5:1742889-1742911 GGTCTCAGCCCCAGTGAGACTGG + Intergenic
985831748 5:2239020-2239042 GATCCCTGCCCCAGAAACCCAGG + Intergenic
993175797 5:84483410-84483432 GTTCCTTGCCCCAATGATCCTGG - Intergenic
993574646 5:89586584-89586606 GATCCCTGCCCCAATGTGCCTGG - Intergenic
995438105 5:112160349-112160371 GGCCACTGACCAAGTGAGCCCGG - Intronic
996342523 5:122454461-122454483 ATTCCCTGCCCCGGTGAGGCCGG - Intronic
997319433 5:132965080-132965102 GGTCGGTGCTGCAGTGAGCCGGG + Intergenic
997634843 5:135397866-135397888 GCTCCCTGCTCCAGGGAGTCGGG - Intronic
997779428 5:136641753-136641775 GCTTCCTGGCCCAGTGACCCTGG + Intergenic
998095063 5:139392160-139392182 GGGCCCTGCCTCAGAGACCCAGG + Exonic
998229963 5:140354834-140354856 GGTCCCTGAGCCTGTGAGCCAGG - Intergenic
999648907 5:153746573-153746595 GGTCTCTGCCTCAGTGGGCCAGG - Intronic
999674804 5:153988368-153988390 GGTCACTGCAACAGTTAGCCAGG + Intergenic
999721819 5:154404184-154404206 GGTCCCGGCCGGAGTCAGCCTGG + Exonic
1001399926 5:171440398-171440420 GGTCTCTGCCCCAGTGAGGGAGG + Intronic
1002326795 5:178415117-178415139 TCTCTCTGCCCCAGTGAGCTGGG + Intronic
1002568624 5:180127885-180127907 GCTCCCTGCCCCCATGAACCGGG - Intronic
1002843711 6:927295-927317 GGTGCCTGCCCCGGTGTCCCAGG - Intergenic
1002925039 6:1601056-1601078 GGGGCCTGGCCCAGTCAGCCAGG - Intergenic
1004129464 6:12905111-12905133 GGTCCCAACCCCATGGAGCCTGG + Intronic
1006173788 6:32109840-32109862 GCTCCCTGCCCCAGACTGCCAGG - Intronic
1006314309 6:33280888-33280910 GGACCCTGCCCCATGGAGCAGGG - Exonic
1007382987 6:41502705-41502727 GGACCCTGGCCCAGTGGGGCTGG - Intergenic
1009992699 6:70863568-70863590 GGTCCCTGCCCCTGGGACACTGG + Intronic
1012909752 6:105105354-105105376 TGTACCAGCCCCAGTTAGCCTGG + Intronic
1013068911 6:106710493-106710515 GATCCCTGCCTCAGTGTGCCTGG + Intergenic
1019535494 7:1527323-1527345 GGTCCGGGCTGCAGTGAGCCAGG + Intergenic
1019560257 7:1652350-1652372 GGGCCCTGATCCAGTGTGCCTGG + Intergenic
1019886305 7:3908995-3909017 GCCCCCTGCTCAAGTGAGCCAGG + Intronic
1020211288 7:6159782-6159804 GGGCTCTGCCGCTGTGAGCCGGG - Intronic
1022370996 7:29771233-29771255 GGTCACTGCCCCACTCAGCAAGG + Intergenic
1023856826 7:44189169-44189191 GGACCCTTCCTCACTGAGCCTGG + Intronic
1023872049 7:44268601-44268623 GGTCCCTGCTCCTGAGAGGCTGG - Intronic
1024947565 7:54825634-54825656 GGGTCCTGCCTCAGTGTGCCTGG - Intergenic
1026932148 7:74229156-74229178 GGTGCCTGCCCCACAAAGCCTGG - Exonic
1028453649 7:91014853-91014875 GGCCCTTGCCCCAGTCAACCAGG - Intronic
1029374204 7:100168219-100168241 GCTCCCTGCTCCGATGAGCCAGG + Intronic
1031993300 7:128211585-128211607 GGTTCCTTCCCCTGAGAGCCTGG - Intergenic
1032429904 7:131852268-131852290 GGCTCCTGGCCCAGTGATCCTGG + Intergenic
1032737229 7:134703501-134703523 GGTCCCATCCCCAGTGGCCCTGG - Intergenic
1033596872 7:142865093-142865115 GGTCCCTGCCTCGCTGGGCCAGG + Intronic
1034226823 7:149490899-149490921 GGACCCTGTCCCAGTGGGCCTGG + Intronic
1035060926 7:156069035-156069057 GCTGCCTGCCCCAGTGTTCCGGG + Intergenic
1035159295 7:156939376-156939398 GGGCCCTGCGCCAGGTAGCCAGG + Intergenic
1037458271 8:19084445-19084467 GGTCCATGCCCCACAGATCCTGG + Intronic
1037590580 8:20308748-20308770 GGTCCCAGCTCCAGTGAAGCTGG - Intergenic
1037752518 8:21692090-21692112 GTGCCCTGCCCCAGTCAGCCTGG - Exonic
1038747460 8:30267004-30267026 GGGCCCTACCCCAGTGCACCTGG + Intergenic
1039155696 8:34554223-34554245 GATCACTGCCCCAGTGTGTCTGG + Intergenic
1040826079 8:51622241-51622263 GAACCCTGCCTGAGTGAGCCTGG + Intronic
1041623431 8:59999393-59999415 TGTTCCTGCCCCAGTCAGCTTGG - Intergenic
1042103055 8:65295227-65295249 ACTCCCTGCCCCAGTGACCCTGG - Intergenic
1042273935 8:66983972-66983994 GCTCCCTTCCCCAGTCAGCCTGG - Intronic
1044901075 8:96945214-96945236 GCTCTCTGCCCCACTGACCCTGG - Intronic
1045267246 8:100630214-100630236 GGTCACAGCCCCACAGAGCCTGG - Intronic
1045497323 8:102719518-102719540 GGTCCCTGCCCTAGTGGGGTGGG - Intergenic
1048262373 8:132955939-132955961 GGTCGCTGCCCCTGTGATCAAGG - Intronic
1049446641 8:142634445-142634467 GGCCCCTGCTCCAGTGAGACTGG + Intergenic
1051195858 9:14562260-14562282 GGCCCCTGCCCAGGTGGGCCCGG + Intergenic
1053314808 9:37042187-37042209 GGCCCCAGCCCCAGAGAGCTTGG + Intergenic
1053415539 9:37944853-37944875 AGTCCCTGCCACAGAGAGTCAGG - Intronic
1056775407 9:89508665-89508687 GTTCCCCTCCCCAGTGTGCCTGG - Intergenic
1058703948 9:107623697-107623719 GGTACCTGGCACAGTGAGACTGG - Intergenic
1059296530 9:113275787-113275809 GCTCCCTGCCAGAGTGAGCTGGG - Intronic
1059432448 9:114258357-114258379 GCTGCTTTCCCCAGTGAGCCAGG + Intronic
1060936435 9:127518797-127518819 GCTGCCTGCCCCACTGGGCCCGG + Intronic
1060996493 9:127877245-127877267 GCTCCCTGCCCCAGAGGACCTGG - Intronic
1061296998 9:129682160-129682182 GCCCCTTGCCCCAGGGAGCCAGG - Intronic
1061547967 9:131315635-131315657 CGTTCCTGCCCCTGTGAGCCTGG + Intergenic
1061994339 9:134176162-134176184 GGACCCTGACCCAGGGACCCTGG + Intergenic
1062078458 9:134605401-134605423 AGTCCCTGCCCCAGTGTGTGCGG - Intergenic
1062203351 9:135321050-135321072 AGCGCCTGCCCCAGTGAGCATGG + Intergenic
1062340665 9:136092635-136092657 TGTCCCTGCCTCAGTGGCCCAGG - Intronic
1062596877 9:137303521-137303543 GGACCCTGCTCCGGTCAGCCAGG - Intergenic
1062615007 9:137392381-137392403 GGACCCTGCCCCCGACAGCCAGG - Intronic
1062631492 9:137465078-137465100 CTTCCCTGCCATAGTGAGCCAGG + Intronic
1185469435 X:373782-373804 GGCCCCGGCCCCAGAGCGCCTGG - Intronic
1189321967 X:40092245-40092267 GGACCCTGCCCCACTCCGCCCGG + Intronic
1192799014 X:74448339-74448361 GGCTCCTGCCCCTCTGAGCCTGG - Intronic
1193044136 X:77034058-77034080 GATCCCTGCCCCAGGTAGCCAGG + Intergenic
1195173990 X:102297356-102297378 AGTCCCTGACCCAGAAAGCCAGG + Intergenic
1195184875 X:102389737-102389759 AGTCCCTGACCCAGAAAGCCAGG - Intronic
1197720110 X:129739219-129739241 GGCAGCAGCCCCAGTGAGCCCGG - Exonic
1200135764 X:153873850-153873872 GGCCTCTGCCCCAGAGAGCTTGG - Intronic
1201490857 Y:14540002-14540024 GGTCCCATCCCCACTGAGTCCGG + Intronic