ID: 1147148202

View in Genome Browser
Species Human (GRCh38)
Location 17:38498342-38498364
Sequence GGCACCCCCCTCTGGGGGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 5, 1: 0, 2: 3, 3: 24, 4: 225}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147148186_1147148202 24 Left 1147148186 17:38498295-38498317 CCCCAGTGAGCCCGGTCTGATGG 0: 3
1: 2
2: 0
3: 9
4: 109
Right 1147148202 17:38498342-38498364 GGCACCCCCCTCTGGGGGGTTGG 0: 5
1: 0
2: 3
3: 24
4: 225
1147148192_1147148202 13 Left 1147148192 17:38498306-38498328 CCGGTCTGATGGAGGAGACATGG 0: 10
1: 14
2: 31
3: 65
4: 246
Right 1147148202 17:38498342-38498364 GGCACCCCCCTCTGGGGGGTTGG 0: 5
1: 0
2: 3
3: 24
4: 225
1147148184_1147148202 29 Left 1147148184 17:38498290-38498312 CCCTGCCCCAGTGAGCCCGGTCT 0: 3
1: 2
2: 0
3: 17
4: 189
Right 1147148202 17:38498342-38498364 GGCACCCCCCTCTGGGGGGTTGG 0: 5
1: 0
2: 3
3: 24
4: 225
1147148185_1147148202 28 Left 1147148185 17:38498291-38498313 CCTGCCCCAGTGAGCCCGGTCTG 0: 3
1: 2
2: 1
3: 12
4: 174
Right 1147148202 17:38498342-38498364 GGCACCCCCCTCTGGGGGGTTGG 0: 5
1: 0
2: 3
3: 24
4: 225
1147148188_1147148202 23 Left 1147148188 17:38498296-38498318 CCCAGTGAGCCCGGTCTGATGGA 0: 3
1: 2
2: 0
3: 3
4: 65
Right 1147148202 17:38498342-38498364 GGCACCCCCCTCTGGGGGGTTGG 0: 5
1: 0
2: 3
3: 24
4: 225
1147148189_1147148202 22 Left 1147148189 17:38498297-38498319 CCAGTGAGCCCGGTCTGATGGAG 0: 3
1: 2
2: 0
3: 9
4: 97
Right 1147148202 17:38498342-38498364 GGCACCCCCCTCTGGGGGGTTGG 0: 5
1: 0
2: 3
3: 24
4: 225
1147148191_1147148202 14 Left 1147148191 17:38498305-38498327 CCCGGTCTGATGGAGGAGACATG 0: 2
1: 13
2: 23
3: 52
4: 308
Right 1147148202 17:38498342-38498364 GGCACCCCCCTCTGGGGGGTTGG 0: 5
1: 0
2: 3
3: 24
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147148202 Original CRISPR GGCACCCCCCTCTGGGGGGT TGG Intronic
900174275 1:1284934-1284956 GGCAGCCCCCACTAGGGGGATGG + Intronic
900357634 1:2272412-2272434 GGAGCCCTCCGCTGGGGGGTTGG + Intronic
900393280 1:2443134-2443156 CCCACCCACCTCTGGGGGGAGGG - Intronic
900395517 1:2451726-2451748 GGGACCCCTCCCTGGGGGCTGGG + Intronic
900524840 1:3123551-3123573 GGCCCCCCTCACTGGGGAGTGGG - Intronic
901868142 1:12121241-12121263 GGAACCCCCCTCTTTGGGGAAGG - Intronic
902282391 1:15384104-15384126 GGCACCCTTCTCTGGGGGTTTGG - Intronic
903807140 1:26013490-26013512 GGCCTCTCCCTCTGGGAGGTGGG - Intergenic
904813089 1:33176519-33176541 GGATCCCCTCTCTGGGGGTTAGG + Intronic
904930418 1:34082512-34082534 GGCCGCCACGTCTGGGGGGTGGG + Intronic
905680904 1:39869950-39869972 GGCTGCCCCGTCTGGGAGGTGGG + Intronic
905900082 1:41575571-41575593 GGCTCCCCTCTCTGGGAGGCAGG + Exonic
906546448 1:46622647-46622669 GGCTCCCCCCTGAGGAGGGTTGG - Intergenic
907341595 1:53739319-53739341 GGCATCCCCCCCTGGGGGTCTGG + Intergenic
912966644 1:114242470-114242492 GGCCGCCCCGTCTGGGAGGTGGG + Intergenic
912966658 1:114242507-114242529 GGCCGCCCCGTCTGGGAGGTGGG + Intergenic
912966688 1:114242584-114242606 GGCCGCCCCGTCTGGGAGGTGGG + Intergenic
914680658 1:149936278-149936300 GGCAGCTGCCTCTGGGGAGTTGG - Intronic
914790902 1:150876597-150876619 GGCTCCTCCCACTGGGGGGGGGG - Exonic
915303785 1:154966411-154966433 GGAACCCCCCTTGGGGGGGGTGG - Exonic
915952069 1:160196040-160196062 GGCAACCCTCTCAGCGGGGTCGG + Intronic
916320331 1:163498433-163498455 GGCCGCCCCGTCTGGGAGGTGGG - Intergenic
916320397 1:163498662-163498684 GGCTGCCCCATCTGGGAGGTAGG - Intergenic
916320540 1:163499147-163499169 GGCCACCCCGTCTGGGAGGTGGG - Intergenic
919520759 1:198584189-198584211 GGCCGCCCCGTCTGGGAGGTGGG - Intergenic
920065503 1:203266721-203266743 GGCCGCCCCGTCTGGGGGGTGGG - Intronic
920100127 1:203512133-203512155 ACCACCCACCCCTGGGGGGTGGG - Intergenic
1063822643 10:9855556-9855578 GGCAGCCCCGACTGGGAGGTGGG - Intergenic
1065265097 10:23966429-23966451 GGCAGCCCACCCTGGTGGGTTGG - Intronic
1067100395 10:43330006-43330028 GGCCGCCCCGTCTGGGAGGTGGG + Intergenic
1067117397 10:43446310-43446332 GGCCACCCCGTCTGGGAGGTGGG - Intronic
1068536352 10:58244349-58244371 GGCCGCCCCCTCTGGGAAGTGGG + Intronic
1070562106 10:77575860-77575882 GGGACTCCCCTCTGGGGGTGGGG - Intronic
1071476803 10:86032265-86032287 GGCCACCCCGTCTGGGAGGTGGG + Intronic
1072480849 10:95809351-95809373 GGCCGCCCCGTCTTGGGGGTGGG - Intronic
1072480866 10:95809388-95809410 GGCCTCCCCGTCTGGGGGGTGGG - Intronic
1072480883 10:95809425-95809447 GGCCGCCCCGTCTGGGAGGTGGG - Intronic
1072480899 10:95809462-95809484 GGCCGCCCCGTCTGGGAGGTGGG - Intronic
1072480972 10:95809660-95809682 GGCCACCCCGTCTGGGAGGTGGG - Intronic
1072480987 10:95809700-95809722 GGCCACCCCGTCTGGGGGGTGGG - Intronic
1073321250 10:102617513-102617535 GGCACCCCTTCCTGGGGGGCTGG + Intronic
1073326058 10:102644450-102644472 GGCTCCCTCCTCCGGGGGGCGGG + Intergenic
1075710413 10:124527650-124527672 GGACTCCCCCTCTGGAGGGTGGG - Intronic
1075892935 10:125970217-125970239 GGCCGCCCCCTCTGGGGGGTGGG - Intronic
1075912127 10:126133641-126133663 GGCACCCATCACTGGGGGGGAGG + Intronic
1076256043 10:129025667-129025689 GGGACCCCTCTCTGAGGGCTGGG + Intergenic
1076724679 10:132407834-132407856 GGCACCATCTTCTGAGGGGTAGG + Intronic
1077473753 11:2776806-2776828 AGCATGGCCCTCTGGGGGGTTGG + Intronic
1077673638 11:4179578-4179600 GTCACCCCTCTGTTGGGGGTGGG + Intergenic
1080869358 11:36223812-36223834 GGGAGCCACCTCTGGGGGATGGG - Intronic
1080907921 11:36565356-36565378 GGCAACCTGCTCAGGGGGGTTGG + Intronic
1081873100 11:46392015-46392037 GGCGCTGCCCTCCGGGGGGTGGG + Intergenic
1083322690 11:61857110-61857132 GACACGCCACTCTGGGGGGAGGG - Intronic
1084215141 11:67642983-67643005 GTCACCCCCCTCTGGGGCCAGGG - Intronic
1085716704 11:78879422-78879444 GGCCGCCCCGTCTGGGAGGTGGG + Intronic
1085716758 11:78879613-78879635 GGCCGCCCCGTCTGGGAGGTGGG + Intronic
1086384371 11:86291976-86291998 GGCACCCCCTGCTGGAGAGTTGG + Intergenic
1089870685 11:121670261-121670283 GGCAGCCTCCACTGGGGAGTGGG - Intergenic
1091278884 11:134370736-134370758 GGCACCCCCTTCTTGGGGAGGGG - Intronic
1091754174 12:3040972-3040994 GGCCCCATCCCCTGGGGGGTGGG + Intergenic
1094051561 12:26226521-26226543 GGGACAGCCCTCTGGGGGTTCGG + Intronic
1095452743 12:42350000-42350022 GGCCACCCCCTCTGGGGGGTGGG - Intronic
1096674875 12:53221063-53221085 GGAACCCCCCTCGGGGCGGGTGG + Intronic
1096965159 12:55620432-55620454 GGCAGCACCTTCTGGGTGGTGGG + Intergenic
1097138534 12:56879538-56879560 GGCCGCCCCATCTGGGAGGTGGG + Intergenic
1097626878 12:62011025-62011047 GGCCACCCCATCTGGGAGGTGGG + Intronic
1102656252 12:114484850-114484872 GGCAGCCCCGTCTGGGGGGTGGG - Intergenic
1103350137 12:120278256-120278278 GGCTCCCCCGTCTGGGAGGTGGG - Intergenic
1103884060 12:124187915-124187937 GGCACCCCCCTCAGAGGGTCGGG - Intronic
1104987115 12:132603499-132603521 GGCACCAGCCTCGTGGGGGTCGG + Intronic
1107644059 13:42476327-42476349 GGCCGCCCCGTCTGGGAGGTGGG + Intergenic
1107644074 13:42476364-42476386 GGCCGCCCCGTCTGGGAGGTGGG + Intergenic
1107644089 13:42476401-42476423 GGCCGCCCCGTCTGGGAGGTGGG + Intergenic
1114594278 14:23898352-23898374 GGCTGCCCCATCTGGGAGGTGGG - Intergenic
1115324856 14:32127799-32127821 GGCCACCCCGTCTGGGAGGTGGG - Intronic
1116502137 14:45635196-45635218 GGCTGCCCCATCTGGGAGGTGGG + Intergenic
1116502227 14:45635493-45635515 GGCTGCCCCGTCTGGGAGGTGGG + Intergenic
1116502264 14:45635605-45635627 GGCCGCCCCGTCTGGGAGGTGGG + Intergenic
1116502278 14:45635642-45635664 GGCCGCCCCGTCTGGGAGGTGGG + Intergenic
1116502292 14:45635679-45635701 GGCCGCCCCGTCTGGGAGGTGGG + Intergenic
1116502306 14:45635716-45635738 GGCCGCCCCGTCTGGGAGGTGGG + Intergenic
1116502320 14:45635753-45635775 GGCCGCCCCGTCTGGGAGGTGGG + Intergenic
1116502334 14:45635790-45635812 GGCCGCCCCGTCTGGGAGGTGGG + Intergenic
1116502348 14:45635827-45635849 GGCCGCCCCGTCTGGGAGGTGGG + Intergenic
1119051777 14:71377126-71377148 GGCCGCCCCATCTGGGGGGTGGG - Intronic
1122577057 14:102749317-102749339 GGCAACCCCCTCTCAAGGGTGGG - Intergenic
1122643745 14:103177684-103177706 GGGACCCCCCTGGGGTGGGTGGG - Intergenic
1122864231 14:104596311-104596333 GGCATCCCACTGTGGGGGGCAGG + Intronic
1122910012 14:104822993-104823015 GGCACCACCCCCTGTGGGGAGGG - Intergenic
1122954077 14:105061729-105061751 GGCACCACCCTCCTGGGGGGGGG + Intronic
1125031951 15:35082585-35082607 GGCCGCCCCGTCTGGGAGGTGGG + Intergenic
1125031990 15:35082698-35082720 GGCCGCCCCGTCTGGGAGGTGGG + Intergenic
1128489705 15:68134582-68134604 AGCCGCCCCGTCTGGGGGGTGGG - Intronic
1128489870 15:68134934-68134956 GGCCGCCCCGTCCGGGGGGTGGG - Intronic
1129150775 15:73686399-73686421 GGCACCACCCGATGGAGGGTTGG + Intronic
1132516577 16:368769-368791 AGCACCCCAGCCTGGGGGGTGGG + Intronic
1132729648 16:1355118-1355140 GTCTCCCGCCTCTGCGGGGTCGG + Intronic
1133833876 16:9350299-9350321 GGCCGCCCCATCTGGGAGGTGGG - Intergenic
1134203157 16:12215546-12215568 GGCACCCCCCTCTGGAGCCCAGG - Intronic
1136687224 16:32002673-32002695 GGCACCCCCCTCTGGGGGGTCGG + Intergenic
1136787837 16:32946224-32946246 GGCACCCCCCTCTGGGGGGTCGG + Intergenic
1136881946 16:33907565-33907587 GGCACCCCCCTCTGGGGGGTCGG - Intergenic
1137578713 16:49620863-49620885 GGCACCTCACCCTGGGGGGCAGG - Intronic
1137787994 16:51152645-51152667 GGCACCCCGCCCTGGGGAGGGGG + Intergenic
1138037712 16:53625329-53625351 GGCTGCCCCATCTGGGTGGTGGG + Intronic
1138037746 16:53625411-53625433 GGCCGCCCCGTCTGGGGGGTGGG + Intronic
1138478247 16:57284583-57284605 GGCACCCACCGCTGGAGGGGCGG - Exonic
1140455795 16:75104922-75104944 GGTCCGCCCCTCTGGGAGGTGGG - Intronic
1142150463 16:88510329-88510351 GGTTCCCCACTCTGTGGGGTTGG + Intronic
1142354789 16:89597273-89597295 GGCCCAGCCCTCTGGGGGGTTGG - Intergenic
1203090065 16_KI270728v1_random:1207881-1207903 GGCACCCCCCTCTGGGGGGTCGG + Intergenic
1143611448 17:8020169-8020191 GGCACCCCCCTTTGAGGAGGTGG + Exonic
1143736110 17:8913146-8913168 GGGACCCCCCTCCAGGGTGTTGG + Intronic
1144576814 17:16434816-16434838 GCCACGCCCCTCTCCGGGGTGGG + Intronic
1144632834 17:16882672-16882694 GGCACCACCCAGTGGGAGGTGGG - Intergenic
1146955436 17:36934403-36934425 GTCACCTCCCTCTGGTGGGCAGG - Intergenic
1147118491 17:38320818-38320840 GGCACCTCCCTCTGGAGTGCTGG + Intronic
1147148202 17:38498342-38498364 GGCACCCCCCTCTGGGGGGTTGG + Intronic
1147190110 17:38733507-38733529 GGCACCCCCTTCTGTGGGAAAGG + Exonic
1148231039 17:45935205-45935227 GGCAGCCCCTACTGGGGGCTGGG + Intronic
1148644385 17:49210870-49210892 GGGTCCCCCCTCCGGGGGCTGGG - Intronic
1152374632 17:79912852-79912874 GGCACACCCCTCTGAGGGCAGGG - Intergenic
1152430648 17:80246731-80246753 TGCAGCCCCCTCTGTGGGGCTGG + Intronic
1152521216 17:80858064-80858086 GGCAGCCACCTCTGGGTCGTGGG + Intronic
1153882107 18:9430502-9430524 GGCCGCCCCGTCTGGGAGGTGGG - Intergenic
1154192646 18:12243408-12243430 GGCTGCCCCGTCTGGGAGGTGGG + Intergenic
1154192658 18:12243445-12243467 GGCCGCCCCGTCTGGGAGGTGGG + Intergenic
1154192678 18:12243516-12243538 GGCTGCCCCGTCTGGGAGGTGGG + Intergenic
1156036182 18:32770379-32770401 GCCACCCCCCTCTCGGGGGAGGG - Exonic
1161530324 19:4785183-4785205 GCCAAACCCCACTGGGGGGTTGG - Intergenic
1162683314 19:12362649-12362671 GGCCGCCCCGTCTGGGAGGTGGG + Intronic
1163007514 19:14406073-14406095 GGCCCCGCCCACCGGGGGGTCGG + Intronic
1164882060 19:31741062-31741084 GGCACCCACATGTGCGGGGTCGG + Intergenic
1166747040 19:45146348-45146370 AGCACCCCCGTCAGGCGGGTGGG - Intronic
1166863450 19:45822662-45822684 GGCACCCCCCTCAGGGAGAGAGG - Intronic
1167151555 19:47713304-47713326 GGCGCCCCCTTGTGGGGAGTGGG - Intergenic
1167636796 19:50660032-50660054 CGCCCCCCCCTCTCGGGGGTAGG + Intronic
927935225 2:27072270-27072292 GACGCCCACCTCCGGGGGGTAGG - Intergenic
929596366 2:43178813-43178835 GCCACCTCCCGCTGGGGCGTTGG + Intergenic
932288190 2:70554021-70554043 GGCACCCCCATCGGGGCGGGAGG - Intronic
940817224 2:158310515-158310537 GGCGGCCCCGTCTGGGGGGTGGG - Intronic
941822332 2:169855982-169856004 AGCCCCCCCATCTGGGAGGTGGG - Intronic
943418411 2:187637040-187637062 GGCCGCCCCGTCTGGGAGGTGGG - Intergenic
946043679 2:216803729-216803751 GGCACCCACGACTGGGGGCTGGG - Intergenic
946310623 2:218880792-218880814 GGCACCGCCCTCGGGGGGGGCGG - Exonic
948836409 2:240628189-240628211 GGCAGCCCCCGCTGGGGGCCAGG - Intronic
949059185 2:241946962-241946984 GGAACGCCCCTCTTGGGGTTTGG + Intergenic
1169065253 20:2691603-2691625 GGCAGCCCCCTGTGGGTGATGGG + Intergenic
1169788425 20:9385414-9385436 GGCCGCCCCGTCTGGGAGGTGGG - Intronic
1170816813 20:19720929-19720951 GGCAGCAGCCTTTGGGGGGTTGG - Intronic
1172275541 20:33677050-33677072 GGGCCCCTCTTCTGGGGGGTGGG - Intronic
1175361417 20:58414375-58414397 GGCCACCCCGTCTGGGAGGTGGG - Intronic
1175361432 20:58414415-58414437 GGCTGCCCCGTCTGAGGGGTGGG - Intronic
1176260592 20:64177612-64177634 GGCACCCCTCTCCGGGGGCGGGG + Intronic
1178408894 21:32347758-32347780 GGCACCCCACCCTGGAGGGCTGG - Exonic
1180080548 21:45485797-45485819 GGAAACCCCCTCTGTGGGGAAGG - Intronic
1180976918 22:19853706-19853728 CTGACCCCCCTCTGGGGGGGGGG + Intronic
1181620075 22:24085010-24085032 GTCAGCCCCCTCTGGGAGGCAGG - Exonic
1184147272 22:42619096-42619118 GGAACCCCGAGCTGGGGGGTTGG - Exonic
1185168182 22:49275146-49275168 GGCACCACCCTCTGGTGGGCTGG - Intergenic
949330479 3:2916793-2916815 GGCGGCCCCGTCTGGGAGGTGGG - Intronic
949853466 3:8440244-8440266 AGCCGCCCCCTCTGGGAGGTGGG + Intergenic
950538073 3:13593213-13593235 AGCAGCCACCTCTGGAGGGTTGG + Intronic
951264156 3:20547883-20547905 AGCCGCCCCGTCTGGGGGGTGGG - Intergenic
954146721 3:48638086-48638108 GGCACCCACCACTGGGGAGCAGG + Exonic
954532143 3:51330243-51330265 GGCACACCACACTGGGGGATGGG + Intronic
958406447 3:93761927-93761949 GGCCACCCCATCTGGGAGGTGGG - Intergenic
958406848 3:93763347-93763369 GGCCTCCCCGTCTGGGAGGTGGG - Intergenic
959054113 3:101551609-101551631 GGCCGCCCCGTCTGGGAGGTGGG + Intergenic
959054159 3:101551722-101551744 GGCCGCCCCGTCTGGGAGGTGGG + Intergenic
961357792 3:126349877-126349899 GGCACCACCCTCTTGGGGGCTGG + Intronic
961386873 3:126527683-126527705 GGCATCCTCCTCTGGTGGGTGGG + Intronic
965136945 3:164784621-164784643 GGCCGCCCCGTCTGGGAGGTGGG + Intergenic
967127215 3:186435390-186435412 GGCCGCCCCGTCTGGGAGGTGGG - Intergenic
968556128 4:1247424-1247446 GCCACCTCCCTCTGGGGTCTGGG - Intronic
969417137 4:7068200-7068222 GGCCCCGCCCACCGGGGGGTGGG - Intergenic
970467787 4:16344628-16344650 GGCACCTCCCTCTGGGCTGGAGG + Intergenic
971669724 4:29542047-29542069 GGCACCCCCTTCTGGGTGAGGGG + Intergenic
972642770 4:40940605-40940627 GGCACCCTCCTGGGGGGGTTAGG + Intronic
972700638 4:41491145-41491167 GGCCGCCCCGTCTGGGAGGTGGG - Intronic
972700683 4:41491297-41491319 GGCTGCCCCGTCTGGGAGGTGGG - Intronic
973021188 4:45207551-45207573 GGCCACCCCATCTGGGAGGTGGG + Intergenic
974597930 4:64037519-64037541 GGCCGCCCCGTCTGGGGGGTGGG + Intergenic
975795932 4:78007197-78007219 GGCCGCCCCCTCTGGGAGGTGGG - Intergenic
975908895 4:79245745-79245767 AGCCACCCCCTCTGGGAGGTAGG + Intronic
979008405 4:115335068-115335090 GGCAATCCCCTCTGGGGATTGGG - Intergenic
983904472 4:173169308-173169330 GGCGTCCCGCTCTGGGGGGCCGG + Intronic
985710799 5:1428579-1428601 GCCACCTCCCTCTGGTGGGTGGG + Intronic
988532937 5:32041194-32041216 GGCCGCCCCGTCTGGGAGGTGGG + Intronic
990709249 5:58563782-58563804 GGCCGCCCCATCTGGGAGGTGGG - Intergenic
992301647 5:75387978-75388000 GTCACCTCCCTCTGGGGAGGAGG - Intronic
993934772 5:93986384-93986406 AGCTGCCCCCTCTGGGAGGTGGG + Intronic
993934790 5:93986421-93986443 GGCTGCCCCATCTGGGGGGTGGG + Intronic
999979086 5:156940755-156940777 GGCTGCCCCATCTGGGAGGTAGG + Intronic
1000630179 5:163583649-163583671 GGCCGCCCCGTCTGGGAGGTGGG - Intergenic
1007987388 6:46220548-46220570 GGCAGCCCTCTCTTGGGGGAAGG - Intergenic
1008909832 6:56720945-56720967 GGCTGCCCCGTCTGGGGGGTGGG - Intronic
1009392864 6:63164367-63164389 GGCTGCCCCATCTGGGAGGTGGG + Intergenic
1009392925 6:63164554-63164576 GGCTGCCCCATCTGGGAGGTGGG + Intergenic
1009868943 6:69432547-69432569 GGCCACCCCATCTGGGAGGTGGG - Intergenic
1009957560 6:70473921-70473943 GGCACCTCAGGCTGGGGGGTTGG - Intronic
1017674258 6:156797259-156797281 AGCACCCCCATGTGGGTGGTTGG - Intronic
1019128341 6:169856656-169856678 GGCCGCCCCATCTGGGAGGTGGG - Intergenic
1020219363 7:6223149-6223171 GGCCGCCCCGTCTGGGAGGTGGG + Intronic
1023954004 7:44871126-44871148 GGCTGCCCCGTCTGGGAGGTGGG - Intergenic
1023954018 7:44871163-44871185 GGCCGCCCCGTCTGGGAGGTGGG - Intergenic
1023954032 7:44871200-44871222 GGCCGCCCCGTCTGGGAGGTGGG - Intergenic
1023954210 7:44871765-44871787 GGCCGCCCCGTCTGGGAGGTGGG - Intergenic
1023954224 7:44871802-44871824 GGCCGCCCCGTCTGGGAGGTGGG - Intergenic
1026894160 7:74000399-74000421 GGCTCCCACCTCAGGGGGCTTGG - Intergenic
1026947788 7:74327497-74327519 GGCACCATCCTCTGTGGGGGTGG - Intronic
1026986069 7:74555746-74555768 GTCAGCTACCTCTGGGGGGTGGG - Intronic
1028535753 7:91888062-91888084 GGCAGCCCCGTCTGGGAAGTGGG + Intergenic
1028535779 7:91888136-91888158 GGCCGCCCCATCTGGGAGGTGGG + Intergenic
1028535931 7:91888705-91888727 GGCCGCCCCGTCTGGGAGGTGGG + Intergenic
1028585248 7:92446097-92446119 GGAACAGCCCTCTGGGGTGTGGG - Intergenic
1029196656 7:98810264-98810286 GACCCCCCTCTCTGGGGGGTGGG - Intergenic
1032179551 7:129663515-129663537 GGCCACCCCGTCTGGGAGGTGGG - Intronic
1033090231 7:138378905-138378927 AGCCGCCCCGTCTGGGGGGTGGG - Intergenic
1039864749 8:41490821-41490843 GACACCCCGCGCTGCGGGGTCGG - Exonic
1040916876 8:52573225-52573247 GGCCGCCCCATCTGGGAGGTGGG - Intergenic
1041523114 8:58776513-58776535 AGCAGCCCCTTCTGGGAGGTGGG + Intergenic
1044581964 8:93833647-93833669 GGCCGCCCCGTCTGGGAGGTGGG - Intergenic
1047735772 8:127763801-127763823 GTCACCCCCATCTGGAGAGTGGG + Intergenic
1049275587 8:141718571-141718593 AGCACTCCCCTCTGCGGTGTGGG + Intergenic
1049481604 8:142827006-142827028 GGCCACCCCGTCTGGGAGGTGGG - Intergenic
1050417977 9:5434592-5434614 GGCCGCCCCCTCTGGGAGGTGGG + Intronic
1052236091 9:26214778-26214800 GGCCGCCCTGTCTGGGGGGTAGG - Intergenic
1052274888 9:26664575-26664597 AGCCGCCCCCTCTGGGAGGTGGG + Intergenic
1052274907 9:26664612-26664634 GGCCGCCCCGTCTGGGGGGTGGG + Intergenic
1053081658 9:35183150-35183172 GGCCGCCCCATCTGGGAGGTGGG - Intronic
1056229052 9:84526478-84526500 GGCTGCCCCGTCTGGGAGGTGGG - Intergenic
1056229108 9:84526669-84526691 GGCCGCCCCGTCTGGGAGGTGGG - Intergenic
1056659760 9:88535168-88535190 GGCACCCGCCTCTGGGAGCGGGG - Exonic
1057674849 9:97130564-97130586 GGCCGCCCCGTCTGGGAGGTGGG - Intergenic
1058049669 9:100393065-100393087 GGCCTCCCCGTCTGGGAGGTGGG + Intergenic
1060080185 9:120636836-120636858 AGCCGCCCCGTCTGGGGGGTGGG + Intronic
1061050401 9:128191599-128191621 GGCAGCGCCCTCTGGGGGACGGG + Intronic
1061312785 9:129775012-129775034 CCCAGCCTCCTCTGGGGGGTGGG - Intergenic
1061678624 9:132231776-132231798 GGCACCCACCTGTGGGCTGTGGG - Intronic
1062054384 9:134463427-134463449 GGCAGCCCGCTGTGGGGGGAAGG - Intergenic
1062136748 9:134933150-134933172 GGCAGGCCCCTCTGGAGGATGGG + Intergenic
1062420095 9:136476554-136476576 CGCACCACCCACTGGGGGCTGGG - Exonic
1186328122 X:8502250-8502272 GGCCGCCCCGTCTGGGAGGTGGG + Intergenic
1186511223 X:10131143-10131165 GGCGCCTCCCTCTCGAGGGTGGG - Intronic
1188214405 X:27458903-27458925 GGCCGCCCCGTCTGGGAGGTGGG + Intergenic
1189421770 X:40862851-40862873 GGCGGCCCCGTCTGGGAGGTGGG + Intergenic
1189870967 X:45382116-45382138 GGCACCCACCACTGGAGGGGCGG - Intergenic
1189882043 X:45503849-45503871 GGCCACCCCTTCTGGGAGGTGGG - Intergenic
1190652048 X:52577094-52577116 GGTAGCCACCTCTGGAGGGTTGG - Intergenic
1191670592 X:63745099-63745121 GGCACCACACTCTGAGGGGGTGG + Intronic
1191828757 X:65392648-65392670 GGCCTCCCCATCTGGGGGGTGGG + Intronic
1192252254 X:69422422-69422444 GGCCGCCCCGTCTGGGAGGTGGG + Intergenic
1192505031 X:71676286-71676308 GGCCGCCCCATCTGGGAGGTGGG + Intergenic
1192663934 X:73069106-73069128 GGCCACCCCGTCTGGGAGGTGGG + Intergenic
1192885665 X:75334725-75334747 GGCTGCCCCGTCTGGGAGGTGGG - Intergenic
1200047124 X:153409041-153409063 GGCAGCCCCCTCCTGGGGGCAGG - Intergenic