ID: 1147149729

View in Genome Browser
Species Human (GRCh38)
Location 17:38507740-38507762
Sequence CCTTCTGGTGTTGTGCATTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 145}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147149724_1147149729 2 Left 1147149724 17:38507715-38507737 CCACATTGCACAACTCCAGGGGG 0: 4
1: 10
2: 25
3: 68
4: 197
Right 1147149729 17:38507740-38507762 CCTTCTGGTGTTGTGCATTGTGG 0: 1
1: 0
2: 0
3: 23
4: 145
1147149719_1147149729 25 Left 1147149719 17:38507692-38507714 CCAGGCTGATCCTAGCAGTGCAA 0: 1
1: 0
2: 0
3: 10
4: 159
Right 1147149729 17:38507740-38507762 CCTTCTGGTGTTGTGCATTGTGG 0: 1
1: 0
2: 0
3: 23
4: 145
1147149720_1147149729 15 Left 1147149720 17:38507702-38507724 CCTAGCAGTGCAACCACATTGCA 0: 1
1: 0
2: 1
3: 9
4: 166
Right 1147149729 17:38507740-38507762 CCTTCTGGTGTTGTGCATTGTGG 0: 1
1: 0
2: 0
3: 23
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147149729 Original CRISPR CCTTCTGGTGTTGTGCATTG TGG Intronic
901508783 1:9703755-9703777 CATTCTGTTGATGTGCATTTGGG + Intronic
902743634 1:18458223-18458245 CCCTCTTGCGTTGTGCAGTGTGG - Intergenic
904807495 1:33142181-33142203 CCTTGTGGTGATGTGCTTTGGGG + Intergenic
907084579 1:51658194-51658216 CATTCTGGCGTTGTGACTTGAGG + Intronic
907584615 1:55605924-55605946 GCTTCTGGGATTGTGCACTGTGG + Intergenic
908341900 1:63189933-63189955 CCCCCTGGTGTTGTTCAATGTGG - Intergenic
910679569 1:89848651-89848673 CCTCCTGGTGTTATGCAGAGTGG + Intronic
911117283 1:94258950-94258972 CCTTGTGGTGTTTTTCATTTGGG + Intronic
911230030 1:95351388-95351410 CCTCCTGGAGTTGTGCAATGAGG + Intergenic
914698725 1:150110606-150110628 CCTTTTCGTGTTGTGCACTGTGG - Exonic
915816928 1:158977377-158977399 CTTTCTGGTGATGTGCATGAAGG + Intergenic
915823885 1:159055487-159055509 CCTTCTGGTGATGTGCATGAAGG + Intergenic
916507142 1:165438381-165438403 ACTTCTGGTGTTAAGCATTTTGG + Intronic
918000222 1:180486858-180486880 CCTCCTGGTCTGATGCATTGAGG + Intronic
919514532 1:198506353-198506375 ACTTCTGGTCTTGAGCATTTTGG + Intergenic
919701366 1:200634628-200634650 CCCCCTGGAGTTGTGCAATGAGG - Intronic
919744719 1:201001294-201001316 CCTTCTAGTGATGGGCATTTAGG - Intronic
924489982 1:244526902-244526924 CCTGCTGGTTTTGTGGCTTGGGG - Intronic
1063310872 10:4950643-4950665 CTTTCTGGTTCTGGGCATTGCGG - Intronic
1064717770 10:18194510-18194532 GCTTCTGGTGTTGTGCCCTGAGG + Intronic
1067940903 10:50654804-50654826 CCTTCTAGTGTTTGGAATTGGGG - Intergenic
1068097115 10:52505208-52505230 CCTGCTGGTTTTGTGGCTTGAGG - Intergenic
1069922892 10:71827986-71828008 CCTTGTGTCCTTGTGCATTGGGG - Intronic
1072450086 10:95532745-95532767 CCCCCTGGAGTTGTGCAATGGGG - Intronic
1073441577 10:103555557-103555579 CCTTTTGGTGGTGGGCACTGGGG + Intronic
1075056794 10:119224751-119224773 TCTTCTCCTGCTGTGCATTGAGG + Intronic
1077587476 11:3464810-3464832 CCTCCTGGTGTTATTCGTTGTGG - Intergenic
1077701294 11:4444551-4444573 CCTTTTTGTGTTGTGCATTAGGG + Intergenic
1078553819 11:12301393-12301415 CCTTCTGTTTTTGGGCATTGAGG + Intronic
1081117330 11:39219891-39219913 CTTTATGGTGTTGTGTTTTGGGG + Intergenic
1084829518 11:71758132-71758154 CCTCCTGGTGTTATTCATTGTGG + Intergenic
1090478705 11:127048500-127048522 CCTTCTTGTGTTGTGTCTTCTGG + Intergenic
1092302554 12:7265767-7265789 CTTTCTGGTACTGTGCACTGTGG + Intergenic
1092413722 12:8273563-8273585 CCTCCTGGTGTTATTCATTGTGG - Intergenic
1093287989 12:17289388-17289410 CCTTCTGGCTTTCTGCATTCAGG - Intergenic
1093908774 12:24722469-24722491 TCTCCTGGTGTTGTGCCATGAGG + Intergenic
1095353327 12:41241089-41241111 ACTTCTGGTCTTGAGCATTTTGG - Intronic
1099759016 12:86893904-86893926 GCTCCTGGTGTAGTGCACTGAGG - Intergenic
1100087010 12:90923730-90923752 TCTTCTGTTTTGGTGCATTGTGG - Intronic
1100122616 12:91386235-91386257 CCTTCTAGTGTTTTGCATATAGG - Intergenic
1103633446 12:122282246-122282268 CCTCCTGGTGGTTTGCATAGTGG - Intronic
1104941781 12:132398596-132398618 CCTCCCGGTGTTGTGCACTGAGG + Intergenic
1105284811 13:18995212-18995234 CCTTCTGGTCTTCTGCCTTCTGG - Intergenic
1105284854 13:18995461-18995483 CCTTCTGGCCTTGTGCCTTCAGG - Intergenic
1105581647 13:21703374-21703396 CCTCCTGCTGATGTGCATTAAGG + Exonic
1108733990 13:53263244-53263266 TCTTGTGGTGTTCTGCAGTGTGG + Intergenic
1111907102 13:94267828-94267850 CTTTCAGCTGTTGTGCAGTGTGG + Intronic
1112172744 13:96991349-96991371 CCATCTGGTGTTCTGAGTTGTGG - Intronic
1115380659 14:32734979-32735001 GCTTCTAGTGTAGTGAATTGGGG + Intronic
1116523391 14:45875951-45875973 CCTTTTGGTATAGTGAATTGGGG - Intergenic
1117547383 14:56804652-56804674 CCTTTTTGTGTTGTGGTTTGGGG - Intronic
1119865398 14:77969051-77969073 CTCCCTGGAGTTGTGCATTGTGG - Intergenic
1121087227 14:91155861-91155883 CCCTCTGGAGTTGTGCCTTGGGG - Intronic
1124647170 15:31446215-31446237 CCTTCTGATATTTAGCATTGTGG + Intergenic
1127835458 15:62787439-62787461 TCTCCTGGTTTTGTGCCTTGGGG - Intronic
1128486379 15:68094461-68094483 CCATCAGGTTTTGTGCAGTGTGG + Intronic
1129498111 15:76006598-76006620 CCTCCTGCTGTTGTGCAATGTGG + Intronic
1130981457 15:88814592-88814614 CCCTCTGGAGTGATGCATTGTGG - Intronic
1134180559 16:12044342-12044364 TCTTCTGGGATTGTGCACTGGGG + Intronic
1134605939 16:15571296-15571318 CCTTTTGGTATAGTGAATTGGGG - Intronic
1135307301 16:21378091-21378113 TCTTCTGGGATTGTGCACTGGGG + Intergenic
1135374997 16:21938384-21938406 CCTTCTGTTGATTTACATTGAGG - Intergenic
1135768588 16:25199036-25199058 CCTTCTGGTGGTGAACATGGTGG + Intergenic
1135850492 16:25958865-25958887 CCATCTGCTTTTGTGCCTTGAGG - Intronic
1136304049 16:29357233-29357255 TCTTCTGGGATTGTGCACTGGGG + Intergenic
1140346309 16:74216375-74216397 CCCCCTGGAGTTGTGCAATGTGG + Intergenic
1142573576 17:891806-891828 CCTTGTTGGGTTGTGCATGGTGG - Intronic
1142573611 17:891953-891975 CCTTGTTGGGTTGTGCATGGTGG - Intronic
1144484867 17:15656149-15656171 CCTAGTGGTGTTCTGCTTTGAGG - Intronic
1145202176 17:20956101-20956123 CCTTCTGGTGCTGGTAATTGCGG - Intergenic
1146780107 17:35662619-35662641 CCTTCTGGTTTGGTGTAGTGTGG + Intronic
1147149724 17:38507715-38507737 CCCCCTGGAGTTGTGCAATGTGG - Intronic
1147149729 17:38507740-38507762 CCTTCTGGTGTTGTGCATTGTGG + Intronic
1151101806 17:71564225-71564247 GCTTCTGGGGTTGTGGATGGTGG + Intergenic
1151352809 17:73541692-73541714 CCTTCTGCCGCTGTGCATTCTGG - Intronic
1151500519 17:74485426-74485448 ACTCCTGGAGTTGTGCAATGTGG + Intergenic
1153456327 18:5286562-5286584 CCTTCTGGAGTTATCCAGTGTGG - Intergenic
1155407246 18:25502232-25502254 CCTTCTGGTTGTGTGACTTGGGG + Intergenic
1155704809 18:28795471-28795493 ACTTCTTGAGTTGTGCAGTGTGG + Intergenic
1158602932 18:58870530-58870552 CCTTTTGGTGCAGTGCCTTGAGG + Intronic
1160378210 18:78429786-78429808 CATCCTGGGGTTGTGCATGGTGG + Intergenic
1163226166 19:15962999-15963021 GCTTCTGGAGTTCTGAATTGGGG - Intergenic
1165717748 19:38057517-38057539 ACTCCTGGTGTTGCTCATTGAGG + Intronic
1166683012 19:44779421-44779443 CCCTCTGCTGTTCTGCACTGAGG + Intronic
925489444 2:4375635-4375657 CCTTGTGGTGTTGGGCATGTGGG - Intergenic
928919880 2:36515697-36515719 CCCTCTTGTGTTTTGCCTTGAGG + Intronic
930362582 2:50400569-50400591 CTTTCTGGTCTAGTGCCTTGTGG - Intronic
932329933 2:70892589-70892611 CTTTCTGGTTTTGTCCAATGGGG - Intergenic
933346675 2:81095198-81095220 TTTCCTGGTGTTCTGCATTGAGG - Intergenic
933920319 2:87039351-87039373 CCCTCTGGTGTTGGGAATTTTGG + Intergenic
933931305 2:87154435-87154457 CCCTCTGGTGTTGGGAATTTTGG - Intergenic
935849523 2:107203395-107203417 CCTTTTGTTGCTGTGCATTTGGG - Intergenic
939254909 2:139730346-139730368 CCTTTTGGCGTAGTGAATTGGGG - Intergenic
944454102 2:199875800-199875822 CCTTGTGGGGTTGGGCATGGTGG + Intergenic
1169307473 20:4504712-4504734 ACTTCTGGAGCTGTGCAATGTGG - Intergenic
1170227178 20:14004028-14004050 ACTTCTGGTCCTGTGCATTTTGG - Intronic
1176213019 20:63934455-63934477 CCCTCTGGGGTCGTGCTTTGAGG + Exonic
1179285636 21:39975307-39975329 CCTTTCTGTGTTGTGTATTGTGG - Intergenic
1181327597 22:22061857-22061879 CCTGCTGGTCTGGTGTATTGTGG + Intergenic
1184506092 22:44903822-44903844 CTTTCTGGTGTTGTTTATTTAGG + Intronic
949533023 3:4976264-4976286 CCCTCTGGAGTTGTGCAATGTGG - Intergenic
949584367 3:5423473-5423495 CTTTCTGGTGTTCTGGGTTGGGG + Intergenic
950271050 3:11615469-11615491 CCTTCCGGTGTGGTGCAGTGCGG - Intronic
954705185 3:52476489-52476511 CCTTCTAGGGTTGTGCCTTCAGG - Exonic
957058757 3:75464414-75464436 CCTCCTGGTGTTATTCACTGTGG - Intergenic
958021119 3:87997450-87997472 CAACCTGGTGTTCTGCATTGTGG + Intergenic
960607681 3:119524706-119524728 ACTTCTGGTCTAGTGAATTGTGG + Exonic
961294686 3:125875286-125875308 CCTCCTGGTGTTATTCATTGTGG + Intergenic
961891275 3:130132195-130132217 CCTCCTGGTGTTATTCATTGTGG - Intergenic
962543944 3:136412579-136412601 CCTCCTGATGTGATGCATTGAGG + Intronic
964420824 3:156501090-156501112 CATACTGGTGTTCTGTATTGAGG - Intronic
964498331 3:157319337-157319359 CCTCCTGGTCTTGTCCACTGAGG - Intronic
969002667 4:3994636-3994658 CCTCCTGGTGTTATTCATTGTGG - Intergenic
969471242 4:7390620-7390642 CCCTCTGCTCTTGTGCAGTGGGG - Intronic
969724820 4:8912742-8912764 CCCTCTGGTGATGGGCATTTGGG + Intergenic
969751355 4:9113892-9113914 CCTCCTGGTGTTATTCATTGTGG + Intergenic
969811264 4:9650176-9650198 CCTCCTGGTGTTATTCATTGTGG + Intergenic
970370613 4:15402183-15402205 TTTTCTGGTGTTGAGGATTGTGG - Intronic
972456773 4:39263078-39263100 CCTTGAGGTGTTGAGGATTGGGG - Intronic
974126561 4:57703783-57703805 TTTTCTAGTGTTGTGCATAGAGG + Intergenic
978855330 4:113387832-113387854 CCTTGTGGCATAGTGCATTGGGG + Intergenic
980617892 4:135256523-135256545 CCTTTTGGTGTGGGGGATTGGGG - Intergenic
983315845 4:166132486-166132508 CATTCTGTGTTTGTGCATTGTGG + Intergenic
984521794 4:180810898-180810920 CCTTCTGTAGGTGTGCATAGTGG + Intergenic
991082359 5:62615069-62615091 CCTTATGGAGCTGTGGATTGCGG + Intronic
991521064 5:67496703-67496725 CCTCCCGGAGTTGTGCAGTGAGG - Intergenic
992066366 5:73113677-73113699 CGTTCTGGTGTTTTTCATTCAGG - Intergenic
992641430 5:78771536-78771558 TCTTCTGGTATAGTGAATTGGGG + Intergenic
995430088 5:112064839-112064861 CCCTCTGAAGTTGTGCAATGTGG + Intergenic
997522860 5:134534464-134534486 CCTGCTGGTGGTGGGCACTGGGG + Intronic
999333200 5:150692225-150692247 CATTCTGGTGTCAAGCATTGAGG - Intronic
1000770605 5:165348810-165348832 GCTTCAGTTGTTGTGCATTCCGG - Intergenic
1003051567 6:2785285-2785307 CCTTCTGCTGTCGTGCCCTGAGG - Exonic
1006803608 6:36774824-36774846 CCTTCTGGAGTTGTGCAGTAGGG - Intronic
1010558979 6:77324599-77324621 CCTTCTGCAGTTATGTATTGAGG - Intergenic
1012078241 6:94722732-94722754 CATCCTTGTGTTGTGCATAGAGG - Intergenic
1014252597 6:119129852-119129874 GCTTCTGATTTTGTGGATTGGGG - Intronic
1015272433 6:131350945-131350967 TTTTCTTGTGTTTTGCATTGTGG - Intergenic
1020321613 7:6942757-6942779 CCTCCTGGTGTTATTCATTGTGG - Intergenic
1021862861 7:24924098-24924120 TCTTCTACTGTTGGGCATTGAGG - Intronic
1022602857 7:31778189-31778211 TCCACTGGGGTTGTGCATTGTGG - Intronic
1022865389 7:34413280-34413302 TCTTCTGTTGATGGGCATTGAGG + Intergenic
1023010383 7:35920320-35920342 CCTTCTGGGGCTGGGCATGGTGG + Intergenic
1024016962 7:45325779-45325801 GCTTTTGGTGGTGTGCATGGTGG + Intergenic
1024080437 7:45851262-45851284 CCTTCTGGGGCTGGGCATGGTGG - Intergenic
1025124028 7:56330414-56330436 CCTTCTGGGGCTGGGCATGGTGG + Intergenic
1025152687 7:56572469-56572491 TCTTCTGTTGATGTGCATTTAGG + Intergenic
1026381059 7:69799791-69799813 CCTCCTGGTGCTGTTCCTTGAGG + Intronic
1033336442 7:140456854-140456876 CCTTCTCTAGTCGTGCATTGAGG - Exonic
1036374561 8:8189306-8189328 CCTCCTGGTGTTATTCACTGTGG + Intergenic
1036854981 8:12233841-12233863 CCTCCTGGTGTTATTCACTGTGG - Intergenic
1036876340 8:12476329-12476351 CCTCCTGGTGTTATTCACTGTGG - Intergenic
1038360065 8:26866596-26866618 CCTTCTGGGGTTGGGCCCTGAGG + Intronic
1039397823 8:37242204-37242226 CCATCTGGGTTTGTGGATTGAGG + Intergenic
1041585312 8:59510306-59510328 CTTTCTGGTGCTGTATATTGTGG + Intergenic
1044342291 8:91060287-91060309 CCTTTTGGCTTTGTGAATTGGGG + Intergenic
1048849006 8:138626644-138626666 CCTTGAGGTGTTGTGCATACAGG + Intronic
1049059240 8:140263346-140263368 GCTTCAGGTGTTGTGCCTTGGGG - Intronic
1050441996 9:5674507-5674529 CCTTTTGGAGTGGTGAATTGGGG - Intronic
1050681587 9:8117735-8117757 CCTTCCAGAGTTCTGCATTGAGG + Intergenic
1057657255 9:96965653-96965675 CATTCTGGTGTTGGACATTTGGG - Intronic
1057795765 9:98156878-98156900 CCTTCAGGTGTTCTGCCTTAAGG + Intronic
1059807612 9:117820323-117820345 TTTTCTGGTTTTGTGCATAGAGG + Intergenic
1060812234 9:126616269-126616291 CTTTCTGGTAGTGTGTATTGAGG + Intronic
1060816353 9:126637552-126637574 CCGTGTGGTGTTGGCCATTGTGG + Intronic
1061247123 9:129406227-129406249 CTTTCTTGTGGTTTGCATTGGGG + Intergenic
1061370784 9:130196187-130196209 CCTCCTGGCATTGTGCAGTGGGG + Intronic
1186781752 X:12919331-12919353 CGTTCTGGTGCTGTACATTGGGG - Exonic
1198102945 X:133437564-133437586 CCTTCTGGTGTTGGACTTTCCGG + Intergenic