ID: 1147150389

View in Genome Browser
Species Human (GRCh38)
Location 17:38510650-38510672
Sequence CAGCGGCCGCCGCAGGCGCA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 314
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 290}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147150389_1147150401 26 Left 1147150389 17:38510650-38510672 CCGTGCGCCTGCGGCGGCCGCTG 0: 1
1: 0
2: 3
3: 20
4: 290
Right 1147150401 17:38510699-38510721 CAGCTGGCGCCGCCACACCGTGG 0: 1
1: 0
2: 0
3: 10
4: 123
1147150389_1147150393 -5 Left 1147150389 17:38510650-38510672 CCGTGCGCCTGCGGCGGCCGCTG 0: 1
1: 0
2: 3
3: 20
4: 290
Right 1147150393 17:38510668-38510690 CGCTGTCGCCCGAGACCCGGCGG 0: 1
1: 0
2: 0
3: 8
4: 45
1147150389_1147150398 10 Left 1147150389 17:38510650-38510672 CCGTGCGCCTGCGGCGGCCGCTG 0: 1
1: 0
2: 3
3: 20
4: 290
Right 1147150398 17:38510683-38510705 CCCGGCGGCGCCGGAGCAGCTGG 0: 1
1: 1
2: 2
3: 19
4: 263
1147150389_1147150402 29 Left 1147150389 17:38510650-38510672 CCGTGCGCCTGCGGCGGCCGCTG 0: 1
1: 0
2: 3
3: 20
4: 290
Right 1147150402 17:38510702-38510724 CTGGCGCCGCCACACCGTGGTGG 0: 1
1: 0
2: 0
3: 3
4: 35
1147150389_1147150394 1 Left 1147150389 17:38510650-38510672 CCGTGCGCCTGCGGCGGCCGCTG 0: 1
1: 0
2: 3
3: 20
4: 290
Right 1147150394 17:38510674-38510696 CGCCCGAGACCCGGCGGCGCCGG 0: 1
1: 0
2: 3
3: 10
4: 138
1147150389_1147150391 -8 Left 1147150389 17:38510650-38510672 CCGTGCGCCTGCGGCGGCCGCTG 0: 1
1: 0
2: 3
3: 20
4: 290
Right 1147150391 17:38510665-38510687 GGCCGCTGTCGCCCGAGACCCGG 0: 1
1: 0
2: 1
3: 3
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147150389 Original CRISPR CAGCGGCCGCCGCAGGCGCA CGG (reversed) Exonic
900120789 1:1047845-1047867 CAGCGGCCGCCTCACCCCCAAGG - Exonic
900136941 1:1121708-1121730 CAGCAGCCGCAGCAGGCCCAGGG + Intergenic
900151467 1:1180942-1180964 CAGGGGCGGGCGCAGGGGCAGGG - Intronic
900206968 1:1435777-1435799 CAGCGCCAGCCGCAAGCTCAGGG - Exonic
900929322 1:5726358-5726380 CAGAGGCAGCTGCAGGAGCAAGG + Intergenic
900929435 1:5726926-5726948 CAGAGGCAGCTGCAGGAGCAAGG - Intergenic
901506303 1:9687974-9687996 CAGAGGCCGCCGAGGGCGGAGGG + Intronic
901606239 1:10461583-10461605 CTGCGTCTGCTGCAGGCGCAGGG + Exonic
902916831 1:19644539-19644561 CCGCGGCCGCCGGACGCGCCGGG - Intronic
904033517 1:27547510-27547532 CAGCGGCTGCAGCAGGGCCACGG + Exonic
905369266 1:37474603-37474625 CGCCGGCCGCCGCTGGCGCATGG + Exonic
906528928 1:46512221-46512243 CAGCCGCCGCTGCAGCAGCAGGG - Exonic
910138420 1:83999176-83999198 CCCCGGCCGCAGCAGGCGAATGG - Intergenic
912649159 1:111422992-111423014 CAGCAGCAGCCTCGGGCGCATGG + Exonic
915326079 1:155081935-155081957 CCGCCGCCGCCGCTGTCGCAGGG + Intronic
915552355 1:156642439-156642461 CAGCAGCAGCTGCAGGCGCTCGG - Intronic
919486854 1:198157104-198157126 CGGCGGACGCTGCAGGCGCGGGG - Exonic
919786313 1:201260482-201260504 CAGCGGCCCCCGGAGGTGCCCGG - Intergenic
921850420 1:219927959-219927981 CAGCGGCAGCAGCTGGCGGAGGG - Exonic
923592156 1:235328479-235328501 CACCGGTCCACGCAGGCGCAGGG - Intronic
1067042035 10:42959982-42960004 CAGTGGCCTCTGCAGGGGCAGGG + Intergenic
1067084215 10:43229608-43229630 CTGCGGCGGGCCCAGGCGCAAGG - Intronic
1067474403 10:46556541-46556563 CTGCGGCCGCCACAGGTGCCAGG + Intergenic
1067713803 10:48671678-48671700 CAGCGGAGGCCGCAGGGGCTCGG + Intergenic
1072043574 10:91633040-91633062 CAGCGACCGCCGCGGGGGCAAGG - Exonic
1073465488 10:103692664-103692686 CAGCGGCCGCCGCAGCCCGGGGG + Intronic
1073812286 10:107164420-107164442 GAGCCGCCGCCGCAGACGCCCGG + Exonic
1074008883 10:109456843-109456865 AAGCCGCCGCCGCAGACGCCCGG + Intergenic
1075501699 10:122980597-122980619 CACCGGCTGCAGCAGGAGCAGGG + Exonic
1075717498 10:124565640-124565662 CAGTGGCCGCCTGGGGCGCACGG - Intronic
1076596377 10:131625199-131625221 CAGCGGCCGCCCCTGGAGCCCGG + Intergenic
1077228900 11:1449960-1449982 CAGCAGCCGCCACAGGAGCGTGG - Intronic
1077492399 11:2867789-2867811 CAGGGGCTGCCGGAGGCGCTGGG + Intergenic
1080628416 11:34051850-34051872 CAGCGGCCTCCGCGCGCGCACGG + Exonic
1080836312 11:35944097-35944119 CAGCGGCCCCAGCAGCCACATGG - Exonic
1081993654 11:47350565-47350587 CAGTGGCCTCAGCAGGGGCAGGG + Exonic
1083430447 11:62611478-62611500 CTGCAGCCGCAGCAGGCGAAGGG + Exonic
1083491855 11:63019563-63019585 CAGCAGCCACAGCAGGAGCAGGG - Intergenic
1083741334 11:64713044-64713066 CAGAGGCCGCCGTTGGCGCAGGG + Exonic
1083811353 11:65108531-65108553 CGGCGGCTGGCGCAGGAGCAGGG + Exonic
1083899802 11:65638144-65638166 CAGCCGCCGCCGCCCGCGCTGGG - Intronic
1084190809 11:67497916-67497938 CAGCAGCCGCCGTGGGAGCATGG - Exonic
1084553981 11:69865000-69865022 CAGAGGCAGCCGCTGGGGCATGG + Intergenic
1087634545 11:100687593-100687615 CGGCGGCCGCGGCGGGCGCTGGG - Intergenic
1089262504 11:117232527-117232549 CAGCTGGCGCCGCCGGGGCACGG - Intergenic
1092810371 12:12266803-12266825 GGGCGGCCGCCGCAGCGGCAGGG + Exonic
1093317309 12:17667110-17667132 CAGCTGCACCCGCAGGTGCAGGG + Intergenic
1097264469 12:57737709-57737731 CACCGGCAGCCGGAGGCTCAAGG - Exonic
1101482021 12:105107643-105107665 CAGGGGCCCCCGCGGTCGCAGGG + Intronic
1102526485 12:113515715-113515737 CAGCGGCCACAGCAGGAGCTGGG + Intergenic
1105027841 12:132861402-132861424 CAGCGGCCCCCGCATGCCCCAGG + Intronic
1105459149 13:20567302-20567324 CACAGGACGCCGCAGGGGCACGG - Intronic
1105809296 13:23980212-23980234 CCGCGGCCCCAGCAGGCTCAAGG + Intronic
1106573910 13:30956746-30956768 CAGCTGCCACTGCAGGTGCATGG - Intronic
1111951277 13:94711390-94711412 CAGCGGCGGCCGCCGCCGCCGGG - Exonic
1112505101 13:99970649-99970671 CTGCGGCCGCCGCAGCCGCCAGG + Exonic
1113200989 13:107867318-107867340 CCGCCGCCGCCGCTGCCGCAGGG + Intergenic
1113378629 13:109784808-109784830 CTGCGGCGGCCGCGGGAGCAAGG - Exonic
1113378661 13:109784911-109784933 GAGCGGCGGCCGCGGGCGCCAGG - Exonic
1113596129 13:111534784-111534806 CAGCGGCCGCTGCAAGCGGTTGG - Intergenic
1113724480 13:112588020-112588042 CCACTGCCGCCGCACGCGCAGGG + Exonic
1115120103 14:29927971-29927993 CAGCGGCCGCAGTGGCCGCAGGG + Intronic
1117512693 14:56469963-56469985 CAGCAGCTGCTGCAGGCACAGGG + Intergenic
1118388821 14:65279764-65279786 CGGCGGCAGCCGTAGACGCAGGG + Intergenic
1121729087 14:96173896-96173918 CAGCGGCCGCTGCAGGCCCAGGG + Intergenic
1122695347 14:103549625-103549647 CAGCGGCCTCTGCAGGCGCAGGG + Intergenic
1122921787 14:104883329-104883351 CGGGGGCCGCCGCTGGCGCAGGG - Exonic
1122969926 14:105148394-105148416 CAGCGGCCGCGGCTGTGGCAGGG + Exonic
1122970613 14:105150668-105150690 CAGAGGCCGCCGCTGTGGCAGGG + Exonic
1126183653 15:45810274-45810296 CAGCGGCCGCAGCATGGTCAAGG + Intergenic
1126849850 15:52790268-52790290 CAGCAGACGCGGCAGGCGCGCGG - Intronic
1127798254 15:62456350-62456372 CAGCTGCAGCCTCAGCCGCACGG + Intronic
1128460606 15:67863866-67863888 CAGCGGCCGCGGGAGGGGCAGGG - Intergenic
1129440669 15:75578908-75578930 TTGCGGCCGCTGCAGGCGCCGGG - Exonic
1129741558 15:77992063-77992085 CAGCGGCAGCAGCAGGAGCAAGG + Intronic
1132588406 16:715948-715970 GAGCTGCCCCCGCAGGCCCACGG + Exonic
1133240599 16:4412091-4412113 CAGTGGCCGCCCCAGGCTCCAGG - Intronic
1135247424 16:20869032-20869054 CAGCGGCCAGCGCTGGCACAGGG - Intronic
1135310692 16:21402686-21402708 AAGCGGCCCCCGCAGACGCTCGG + Exonic
1135310735 16:21402938-21402960 AAGCGGCCCCCGCAGACGCTCGG + Exonic
1135310757 16:21403064-21403086 AAGCGGCCCCCGCAGACGCTCGG + Intronic
1135310779 16:21403190-21403212 AAGCGGCCCCCGCAGACGCTCGG + Intronic
1135310825 16:21403455-21403477 AAGCGGCCCCCGCAGACGCTCGG + Intronic
1135310846 16:21403581-21403603 AAGCGGCCCCCGCAGACGCTCGG + Intronic
1135310868 16:21403707-21403729 AAGCGGCCCCCGCAGACGCTCGG + Intronic
1135310945 16:21404189-21404211 AAGCGGCCCCCGCAGACGCTCGG + Intronic
1135310968 16:21404316-21404338 AAGCGGCCCCCGCAGACGCTCGG + Intronic
1135310986 16:21404429-21404451 AAGCGGCCCCCGCAGACGCTCGG + Intronic
1135311009 16:21404553-21404575 AAGCGGCCCCCGCAGACGCTCGG + Intronic
1135311031 16:21404679-21404701 AAGCGGCCCCCGCAGACGCTCGG + Intronic
1135363640 16:21835120-21835142 AAGCGGCCCCCGCAGACGCTCGG + Exonic
1135363662 16:21835246-21835268 AAGCGGCCCCCGCAGACGCTCGG + Exonic
1135363684 16:21835372-21835394 AAGCGGCCCCCGCAGACGCTCGG + Exonic
1135363706 16:21835498-21835520 AAGCGGCCCCCGCAGACGCTCGG + Exonic
1135363728 16:21835624-21835646 AAGCGGCCCCCGCAGACGCTCGG + Exonic
1135363750 16:21835750-21835772 AAGCGGCCCCCGCAGACGCTCGG + Exonic
1135363795 16:21836015-21836037 AAGCGGCCCCCGCAGACGCTCGG + Exonic
1135363817 16:21836141-21836163 AAGCGGCCCCCGCAGACGCTCGG + Exonic
1135363839 16:21836267-21836289 AAGCGGCCCCCGCAGACGCTCGG + Exonic
1135363895 16:21836626-21836648 AAGCGGCCCCCGCAGACGCTCGG + Exonic
1135363917 16:21836752-21836774 AAGCGGCCCCCGCAGACGCTCGG + Exonic
1135363939 16:21836878-21836900 AAGCGGCCCCCGCAGACGCTCGG + Exonic
1135363982 16:21837130-21837152 AAGCGGCCCCCGCAGACGCTCGG + Exonic
1135447859 16:22534218-22534240 AAGCGGCCCCCGCAGACGCTCGG - Exonic
1135447902 16:22534470-22534492 AAGCGGCCCCCGCAGACGCTCGG - Exonic
1135447920 16:22534584-22534606 AAGCGGCCCCCGCAGACGCTCGG - Exonic
1135447976 16:22534940-22534962 AAGCGGCCCCCGCAGACGCTCGG - Exonic
1135447998 16:22535066-22535088 AAGCGGCCCCCGCAGACGCTCGG - Exonic
1135448019 16:22535192-22535214 AAGCGGCCCCCGCAGACGCTCGG - Exonic
1135448041 16:22535318-22535340 AAGCGGCCCCCGCAGACGCTCGG - Exonic
1135448062 16:22535444-22535466 AAGCGGCCCCCGCAGACGCTCGG - Exonic
1135448108 16:22535709-22535731 AAGCGGCCCCCGCAGACGCTCGG - Exonic
1135448130 16:22535835-22535857 AAGCGGCCCCCGCAGACGCTCGG - Exonic
1135448152 16:22535961-22535983 AAGCGGCCCCCGCAGACGCTCGG - Exonic
1136307417 16:29381761-29381783 AAGCGGCCCCCGCAGACGCTCGG + Exonic
1136307438 16:29381887-29381909 AAGCGGCCCCCGCAGACGCTCGG + Exonic
1136307460 16:29382013-29382035 AAGCGGCCCCCGCAGACGCTCGG + Exonic
1136307482 16:29382139-29382161 AAGCGGCCCCCGCAGACGCTCGG + Exonic
1136307527 16:29382404-29382426 AAGCGGCCCCCGCAGACGCTCGG + Exonic
1136307549 16:29382530-29382552 AAGCGGCCCCCGCAGACGCTCGG + Exonic
1136307571 16:29382656-29382678 AAGCGGCCCCCGCAGACGCTCGG + Exonic
1136307593 16:29382782-29382804 AAGCGGCCCCCGCAGACGCTCGG + Exonic
1136307615 16:29382908-29382930 AAGCGGCCCCCGCAGACGCTCGG + Exonic
1136307714 16:29383537-29383559 AAGCGGCCCCCGCAGACGCTCGG + Exonic
1136307756 16:29383789-29383811 AAGCGGCCCCCGCAGACGCTCGG + Exonic
1136320962 16:29484091-29484113 AAGCGGCCCCCGCAGACGCTCGG + Intronic
1136320983 16:29484217-29484239 AAGCGGCCCCCGCAGACGCTCGG + Intronic
1136321005 16:29484343-29484365 AAGCGGCCCCCGCAGACGCTCGG + Intronic
1136321052 16:29484608-29484630 AAGCGGCCCCCGCAGACGCTCGG + Intronic
1136321074 16:29484734-29484756 AAGCGGCCCCCGCAGACGCTCGG + Exonic
1136321096 16:29484860-29484882 AAGCGGCCCCCGCAGACGCTCGG + Exonic
1136321150 16:29485219-29485241 AAGCGGCCCCCGCAGACGCTCGG + Exonic
1136435535 16:30223431-30223453 AAGCGGCCCCCGCAGACGCTCGG + Exonic
1136435556 16:30223557-30223579 AAGCGGCCCCCGCAGACGCTCGG + Exonic
1136435578 16:30223683-30223705 AAGCGGCCCCCGCAGACGCTCGG + Exonic
1136435600 16:30223809-30223831 AAGCGGCCCCCGCAGACGCTCGG + Exonic
1136435622 16:30223935-30223957 AAGCGGCCCCCGCAGACGCTCGG + Exonic
1136435644 16:30224061-30224083 AAGCGGCCTCCGCAGACGCTCGG + Exonic
1136435689 16:30224326-30224348 AAGCGGCCCCCGCAGACGCTCGG + Exonic
1136435711 16:30224452-30224474 AAGCGGCCCCCGCAGACGCTCGG + Exonic
1136435765 16:30224811-30224833 AAGCGGCCCCCGCAGACGCTCGG + Exonic
1136435787 16:30224937-30224959 AAGCGGCCCCCGCAGACGCTCGG + Exonic
1136435809 16:30225063-30225085 AAGCGGCCCCCGCAGACGCTCGG + Exonic
1136435831 16:30225189-30225211 AAGCGGCCCCCGCAGACGCTCGG + Exonic
1141669842 16:85485939-85485961 CAGCGGCCAGTGCAGGCTCATGG - Intergenic
1141704881 16:85659261-85659283 CAGAGGCCACAGCAGGCACACGG - Intronic
1141915498 16:87093893-87093915 GAGCAGCCGCAGCAGCCGCAGGG + Intronic
1142188385 16:88705864-88705886 GAGCGCCCGCCGCAGCCGCCGGG + Intronic
1142421440 16:89972829-89972851 CCGCGGCCGGCGCAGGCGAATGG - Intergenic
1142697928 17:1643817-1643839 CCGTGGGGGCCGCAGGCGCACGG + Exonic
1143019790 17:3911455-3911477 CAGGGGCCGCCCCAGGCGTGAGG + Intronic
1143240395 17:5438862-5438884 CAGCCACAGCCACAGGCGCAGGG + Exonic
1143495021 17:7307843-7307865 GAGCGGCGGCCGCCGCCGCACGG + Intronic
1144339675 17:14301376-14301398 CAGCGGCGGCCGCGGGCACACGG + Exonic
1145276999 17:21437511-21437533 CAGAGGCAGCAGCAGGAGCAGGG - Intergenic
1145284551 17:21495636-21495658 CAGCTGCAGGCCCAGGCGCATGG - Intergenic
1146057699 17:29589438-29589460 CAGGGGCCGCCGCCGCCGCCCGG - Exonic
1147150389 17:38510650-38510672 CAGCGGCCGCCGCAGGCGCACGG - Exonic
1147987526 17:44315088-44315110 CAGCGGCCAGCGCAGACGCGCGG + Intronic
1148032107 17:44628535-44628557 CAGGGGCAGCGGCAGGGGCAGGG + Intergenic
1150326683 17:64263320-64263342 CGGCGGCGGCCGCGGGCGCGGGG - Intergenic
1152143054 17:78549841-78549863 CAGGGGCCGCAGCAGGTGCAGGG - Intronic
1152681868 17:81672633-81672655 CAGCGGCAGCAGCAGCTGCACGG + Exonic
1152824813 17:82458316-82458338 CCGCGGCCTCCGCGGGCCCAGGG + Intronic
1155053201 18:22165646-22165668 TGGCGGCCGCCGGCGGCGCACGG + Intergenic
1160397313 18:78582085-78582107 CAGCGGGCTCAGCAGGCTCACGG + Intergenic
1160923888 19:1533820-1533842 CAGCCGCCGCCGCAGGCAGCCGG - Intronic
1161911553 19:7198188-7198210 CTGCGGCCGCCGCAACCGCCGGG - Intronic
1162799977 19:13104952-13104974 CAGCGGCAGCCCCAGGTCCAGGG + Exonic
1163427094 19:17245742-17245764 GAGCGGCAGCCGCGGGCGCCGGG - Exonic
1163607135 19:18281565-18281587 CCGCGGCCGGGGCGGGCGCAGGG - Exonic
1163806932 19:19405445-19405467 CAGCGCCCTCCGCAGGCCGAAGG - Intronic
1165328289 19:35126624-35126646 CAGCAGCCGCCGCGGGGCCAGGG + Exonic
1165956986 19:39507254-39507276 CAGCGGCCGCCGTGAGCACAGGG - Exonic
1166304097 19:41928006-41928028 CCGCGGCCGGCGCAGGGGCGGGG - Intronic
1166748342 19:45152520-45152542 CTGCTGCTGCAGCAGGCGCACGG + Exonic
1167321643 19:48800184-48800206 CACCGGCAGGCACAGGCGCATGG + Exonic
1168078556 19:53993214-53993236 CAGCCGCCGCCCCGAGCGCAGGG + Intronic
1168671431 19:58243996-58244018 CAGCGGCCTCTTCAGGTGCAGGG + Exonic
927652294 2:24920043-24920065 CCGCCGCCGCCGCGGGTGCAGGG - Intergenic
927751404 2:25673568-25673590 CAGCGCCCGCCCCCGGCGCGAGG + Exonic
928313897 2:30231772-30231794 AGACGCCCGCCGCAGGCGCAGGG - Intronic
929822718 2:45286236-45286258 CAGGGGCCGCCCCAGGCTCTGGG + Intergenic
931254110 2:60555285-60555307 CAGCCGCCGCCGCCGCCGCCGGG + Intergenic
931429212 2:62196079-62196101 CAGCAGCCGCCGCGGGCGCCCGG - Intergenic
934059902 2:88283992-88284014 CAGCGGCCCAGGCAGGCACAAGG - Intergenic
937284561 2:120741838-120741860 CACCGGCCGCCGCCGGCGAGTGG + Intronic
937983227 2:127627033-127627055 CAGCGGCCACTGCAGGCGGGCGG - Exonic
938094120 2:128450581-128450603 CAGCCGCTGCCCCAGGCCCAGGG - Intergenic
938458830 2:131484585-131484607 CAGCGGCAGCAGCAGCAGCAGGG + Intronic
939178614 2:138780221-138780243 GGGCAGCGGCCGCAGGCGCATGG + Exonic
946249978 2:218405990-218406012 CCACGGCAGCCGCAGGTGCAAGG - Intergenic
946404104 2:219483669-219483691 CCGCAGCAGCCGCTGGCGCAGGG - Exonic
946929164 2:224655521-224655543 CAGCCGCCTCCGGAGGGGCAGGG + Intergenic
948154573 2:235771062-235771084 GTGCGGCCGCCGCAGGTGCTGGG + Intronic
948824563 2:240568159-240568181 CAGCGGCTGCCCCAGGGGCCTGG + Intronic
1170589696 20:17762521-17762543 CACAGGCCGCCACAGGTGCAGGG + Intergenic
1171180255 20:23086160-23086182 CAGCAGCAGCAGCAGGCCCATGG + Exonic
1172502100 20:35434638-35434660 CAGCGGCCCCCGGAGGCGGGCGG - Exonic
1173690880 20:44960206-44960228 CTGCGGGTGCTGCAGGCGCAAGG - Exonic
1176068920 20:63216014-63216036 CAGCAGCCGCCGCCGCCGCCCGG - Exonic
1176154774 20:63613385-63613407 CAGTGGCAGACACAGGCGCACGG - Intronic
1176379195 21:6103349-6103371 CAGAGGCAGCAGCAGGGGCAGGG + Intergenic
1176379201 21:6103367-6103389 CAGGGGCAGCAGCAGGGGCAGGG + Intergenic
1176379209 21:6103391-6103413 CAGAGGCAGCGGCAGGGGCAGGG + Intergenic
1176379212 21:6103397-6103419 CAGCGGCAGGGGCAGGGGCAGGG + Intergenic
1176379221 21:6103421-6103443 CAGGGGCAGCAGCAGGGGCAGGG + Intergenic
1176952774 21:15065369-15065391 CCGCGACCGCTGCAGGCGCCTGG + Intergenic
1178453710 21:32727979-32728001 CAGCCGCCGCCACAGCCGCCGGG + Exonic
1179744252 21:43434816-43434838 CAGGGGCAGCAGCAGGGGCAGGG - Intergenic
1179744261 21:43434840-43434862 CAGCGGCAGGGGCAGGGGCAGGG - Intergenic
1179744264 21:43434846-43434868 CAGAGGCAGCGGCAGGGGCAGGG - Intergenic
1179744272 21:43434870-43434892 CAGGGGCAGCAGCAGGGGCAGGG - Intergenic
1179744278 21:43434888-43434910 CAGAGGCAGCAGCAGGGGCAGGG - Intergenic
1180871633 22:19150075-19150097 CAGCAGCAGCAGCAGGCGCAGGG + Exonic
1181466444 22:23113083-23113105 CAGGGTCAGCCGCAGGGGCAGGG - Intronic
1182296456 22:29313328-29313350 CAGCGCCCCCTGCAGGCGCAGGG + Exonic
1183485601 22:38086271-38086293 CAGCAGCCGCCGCAGCAGCATGG - Exonic
1183578253 22:38706154-38706176 CAGCGCCCGCCGCCGCCGCCCGG - Intronic
1183702288 22:39457409-39457431 CAGCGGCTGCGGCGGGCGCCCGG - Exonic
1185155709 22:49192265-49192287 CAGCGGCCAACCCAGGTGCAAGG + Intergenic
1185414846 22:50704364-50704386 AAGCGGGAGCCGCAGGGGCAAGG - Intergenic
951543609 3:23806045-23806067 CAGCAGCCGCCGCGGCGGCACGG + Exonic
954109835 3:48427799-48427821 CAGCGGCCTCCTCAGGAGCCTGG - Intronic
954378261 3:50205954-50205976 CAGCGGGCACAGCGGGCGCAGGG + Intronic
954870333 3:53763076-53763098 CAGCAGCCACCACAGGCTCAGGG - Intronic
959085824 3:101849761-101849783 CAGCTGGCGTCGCAGGCGCCCGG - Exonic
961167321 3:124772416-124772438 CAGCAGCCGCTGCAGGCGCAGGG + Intronic
962316308 3:134361606-134361628 GAGCGGCTGCAGCAGGCGCTCGG - Exonic
962367663 3:134796667-134796689 CAGCGGCCGCGGCAGCCTCCTGG + Intronic
966860690 3:184229771-184229793 CAGTGGCCGCGGCCCGCGCAGGG - Intronic
968048063 3:195635193-195635215 CCGCGCCCGCAGCAGGCCCAGGG - Intergenic
968099339 3:195954427-195954449 CCGCGCCCGCAGCAGGCCCAGGG + Intergenic
968225217 3:196968835-196968857 GGGCCGCCGCCGCCGGCGCAGGG + Intronic
968258063 3:197297586-197297608 CTGCGGCCGCTGCTGGCTCAGGG - Intronic
968306548 3:197654728-197654750 CCGCGCCCGCAGCAGGCCCAGGG + Intergenic
968729265 4:2262002-2262024 CAGCGGCCGCCGCCGTCCCGGGG - Exonic
968845697 4:3040539-3040561 CAGCGGCGGCCTCAGGCACACGG - Intronic
968902750 4:3439078-3439100 CAGGGGCCCCCCCAGGCCCAGGG - Intronic
970333071 4:15003913-15003935 CAGCCGCAGCCGCAGCCGCCCGG + Exonic
972754303 4:42029173-42029195 CAGCAGCTGCCGCAGTCGGAAGG - Intronic
978503501 4:109433675-109433697 CGGCGGCCGCCGCGGGCGCGGGG - Intergenic
978619329 4:110622918-110622940 CAGCGGCTGCTGCCGCCGCAGGG - Exonic
984206506 4:176792891-176792913 CGGCGGCGGCGGCGGGCGCAGGG + Intergenic
984206509 4:176792897-176792919 CGGCGGCGGGCGCAGGGGCAGGG + Intergenic
984778540 4:183504732-183504754 CAGAGGCGGCCGCGGGCGGAGGG + Intergenic
984778777 4:183505601-183505623 CAGCGGCAGCTGCAGCCGCTGGG - Intronic
985743526 5:1633848-1633870 CCGCGCCCGCAGCAGGCCCAGGG + Intergenic
985790835 5:1926237-1926259 CAGGGGCTGGGGCAGGCGCACGG - Intergenic
985886883 5:2686934-2686956 CAGAGGCTGCCGCTGGAGCAGGG + Intergenic
987082822 5:14441056-14441078 CAGCGGCCGGCGCCAGCCCACGG - Intronic
992067458 5:73120712-73120734 CCGCCGCCGGCGCAGGCGCGCGG - Intronic
992269931 5:75053547-75053569 GGGCGGCCTCCGCAGCCGCACGG - Intergenic
992732802 5:79689790-79689812 GAGCCGCCCCCGCAGGGGCAGGG + Intergenic
999133155 5:149299745-149299767 CAGGGGCTGCCGCAGGAGGAAGG + Intronic
1002645199 5:180649409-180649431 CAGCGCCCGCCCCAGGTGCGCGG + Intronic
1002888208 6:1313550-1313572 CAGCCGCCGCCTCAGGGACACGG + Exonic
1005940474 6:30556272-30556294 CAGCCCCCGCCGCAGGGGCCCGG + Exonic
1007759880 6:44127562-44127584 CCGCGGCCGCCGCAGGAGCCCGG + Intronic
1012625029 6:101393981-101394003 CAGCGGGCGCCCCGAGCGCACGG - Intergenic
1013349189 6:109290540-109290562 CGGCGGCCGTCGCTGGGGCAGGG - Intergenic
1013619375 6:111873139-111873161 CGGCGGCCGCCGCCCGCGCCAGG - Exonic
1015947321 6:138516098-138516120 CAGCCGAAGCCGCAGGAGCATGG - Intronic
1016010781 6:139135584-139135606 CGGCGGGCGCCGGAGGCGCGGGG + Exonic
1017324583 6:153130972-153130994 CAGCCGCCCCCGCCGGGGCATGG + Intronic
1018109415 6:160520527-160520549 CAGCAGGCGCCGCAGGCTCCTGG - Intergenic
1018810801 6:167296486-167296508 CAGGTGCCTCCGCAGGGGCAGGG + Intronic
1019640891 7:2103115-2103137 CAGAGGCAGCAGCAAGCGCAGGG - Intronic
1019642163 7:2109335-2109357 AAGCGGCTGCAGCAGCCGCAGGG + Intronic
1020094418 7:5360714-5360736 CACCAGCCGCAGCAGGGGCAGGG - Intronic
1022456620 7:30563773-30563795 CAGCGGCTTCAGCAGGAGCATGG - Intergenic
1024633730 7:51269562-51269584 CAGTGGCCGGAGCAGGGGCAGGG - Intronic
1025690503 7:63751382-63751404 CAGTGGCCTCCTCAGGCCCAGGG + Intergenic
1025690950 7:63753205-63753227 CAGTGGCCTCCTCAGGCCCATGG + Intergenic
1025691826 7:63756804-63756826 CAGTGGCCTCCTCAGGCCCATGG + Intergenic
1025692274 7:63758627-63758649 CAGTGGCCTCCTCAGGCCCATGG + Intergenic
1025693136 7:63762129-63762151 CAGTGGCCTCCTCAGGCCCATGG + Intergenic
1025693581 7:63763952-63763974 CAGTGGCCTCCTCAGGCCCATGG + Intergenic
1026627925 7:72012660-72012682 CAGAGGCTGCAGGAGGCGCAAGG - Intronic
1026891216 7:73983884-73983906 TAGCGGCAGCCGCTGGTGCACGG - Intergenic
1026999689 7:74643724-74643746 CAAAGGCCACAGCAGGCGCAAGG + Intergenic
1027256278 7:76432757-76432779 CAGGGGCAGCCTCAGGCTCAAGG + Intronic
1028268566 7:88759236-88759258 CAGCTGCCGCTGCAGCCGCGGGG - Intergenic
1029581939 7:101442127-101442149 CAGGGCCCGGGGCAGGCGCAAGG - Intronic
1034284251 7:149874004-149874026 CAGCGGGCGCTGCAGGTGCGCGG - Exonic
1034440967 7:151086063-151086085 CAGCAGCACCCTCAGGCGCAGGG + Intronic
1034560678 7:151877506-151877528 CTGCGGCCGCCGCAGGGGTCTGG - Intergenic
1034560682 7:151877514-151877536 CTGCGGCGGCCGCAGCCGCTTGG + Intergenic
1034867770 7:154656456-154656478 CAGCAGCCGCAGCATGTGCAGGG + Intronic
1035106624 7:156446525-156446547 CAGAGGCCCCAGCAGGGGCAAGG - Intergenic
1035333409 7:158111042-158111064 CAGCTGCCCCCTCAGGCACAAGG + Intronic
1035355383 7:158273461-158273483 CAGGGGGAGCCGCAGGCACAGGG + Intronic
1035355389 7:158273479-158273501 CAGGGGGAGCCGCAGGCACAGGG + Intronic
1035355408 7:158273553-158273575 CAGGGGGAGCCGCAGGCACAGGG + Intronic
1035355588 7:158274375-158274397 CAGGGGGAGCCGCAGGCACAGGG + Intronic
1035431932 7:158829155-158829177 CAGCGCGCGGCACAGGCGCAGGG + Exonic
1037878539 8:22561407-22561429 GAGGGGCGGACGCAGGCGCAGGG - Intronic
1037882889 8:22581503-22581525 CAGCTGCAGCCGCAGGGGCGAGG - Exonic
1039467982 8:37797303-37797325 CAGCGGCAGCAGCAGGCGCGCGG - Exonic
1046848940 8:118951742-118951764 CAGCAGCCTCCCCAGGCGCCGGG + Intronic
1048298130 8:133230512-133230534 CAGAGGCCTCCGCAAGAGCAGGG - Intergenic
1049312962 8:141943111-141943133 CAGCGGCACCTGCAGGCACAGGG - Intergenic
1051170305 9:14314288-14314310 CAGCCGCCGCCGCCCGCGCCGGG + Intronic
1053119940 9:35538884-35538906 CAGCAGCCGCGGCAGCAGCACGG + Exonic
1056135157 9:83623461-83623483 CTGCGGCGACCGCAGGCTCAGGG + Intronic
1057190152 9:93082854-93082876 CAGCTGCTGCCGCTGCCGCAGGG + Intronic
1061128291 9:128690005-128690027 CAGCCGCCGCCGCCGCCACATGG + Intronic
1061365931 9:130172497-130172519 CAGCGGCCGCCCCACGCCCCGGG + Intergenic
1062349695 9:136132879-136132901 CTGAGGCCGCCCCACGCGCAGGG + Intergenic
1203771144 EBV:50689-50711 CGGCGGCCACCACGGGCGCACGG + Intergenic
1186705918 X:12138891-12138913 CAGCAGCCTCCGCAGCCCCATGG - Exonic
1188691196 X:33131178-33131200 CAGCAGCCGCAGCAGCCCCAGGG - Intronic
1200049447 X:153421080-153421102 CCGCAGTCGCCGCAGGCGAAGGG - Exonic
1201343799 Y:12960669-12960691 CAGAGACCCCCGCAGGGGCAAGG - Intergenic