ID: 1147150393

View in Genome Browser
Species Human (GRCh38)
Location 17:38510668-38510690
Sequence CGCTGTCGCCCGAGACCCGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 45}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147150386_1147150393 21 Left 1147150386 17:38510624-38510646 CCGCGGCACGGCGGACGACATGC 0: 1
1: 0
2: 0
3: 0
4: 19
Right 1147150393 17:38510668-38510690 CGCTGTCGCCCGAGACCCGGCGG 0: 1
1: 0
2: 0
3: 8
4: 45
1147150389_1147150393 -5 Left 1147150389 17:38510650-38510672 CCGTGCGCCTGCGGCGGCCGCTG 0: 1
1: 0
2: 3
3: 20
4: 290
Right 1147150393 17:38510668-38510690 CGCTGTCGCCCGAGACCCGGCGG 0: 1
1: 0
2: 0
3: 8
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147150393 Original CRISPR CGCTGTCGCCCGAGACCCGG CGG Exonic