ID: 1147150393

View in Genome Browser
Species Human (GRCh38)
Location 17:38510668-38510690
Sequence CGCTGTCGCCCGAGACCCGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 45}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147150386_1147150393 21 Left 1147150386 17:38510624-38510646 CCGCGGCACGGCGGACGACATGC 0: 1
1: 0
2: 0
3: 0
4: 19
Right 1147150393 17:38510668-38510690 CGCTGTCGCCCGAGACCCGGCGG 0: 1
1: 0
2: 0
3: 8
4: 45
1147150389_1147150393 -5 Left 1147150389 17:38510650-38510672 CCGTGCGCCTGCGGCGGCCGCTG 0: 1
1: 0
2: 3
3: 20
4: 290
Right 1147150393 17:38510668-38510690 CGCTGTCGCCCGAGACCCGGCGG 0: 1
1: 0
2: 0
3: 8
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147150393 Original CRISPR CGCTGTCGCCCGAGACCCGG CGG Exonic
916651678 1:166839645-166839667 CCCAGCCGCCCGGGACCCGGGGG - Intronic
918275813 1:182953028-182953050 CGCTGTCTCCGGGGACACGGCGG - Exonic
1063458970 10:6203506-6203528 CGCTGTGGCCCTTGTCCCGGTGG + Intronic
1064086317 10:12349102-12349124 CGCTGTGGCCTGTGGCCCGGGGG - Intergenic
1064110039 10:12530642-12530664 CGCTGCCTCCCCAGACCCCGAGG - Intronic
1070306064 10:75239904-75239926 CGCTGTCGCCCGAGATCCCCCGG + Intergenic
1075645191 10:124092416-124092438 CGCCGCCTCCCGAGACGCGGCGG + Intronic
1075712608 10:124538558-124538580 CGCTGTGGCCCCATACCTGGGGG + Intronic
1076993720 11:288775-288797 CGCTGTCGCCCGAGGGCTCGGGG - Intergenic
1081812872 11:45923080-45923102 CGCCCTCGACGGAGACCCGGGGG + Exonic
1083632742 11:64104150-64104172 CGCTGCCGCCCAAGACCCTCTGG - Exonic
1084387919 11:68855572-68855594 CGCAGAGCCCCGAGACCCGGAGG + Intergenic
1097014355 12:55974522-55974544 ACCTGTCGCCCGAGCCCCGGGGG + Intronic
1102027018 12:109719453-109719475 CCCTGTCGCCCGTGTCCCAGTGG + Intronic
1113378510 13:109784364-109784386 CCGCGTCCCCCGAGACCCGGCGG + Exonic
1113742921 13:112723863-112723885 CTGTCTCGCCCGAAACCCGGAGG + Intronic
1129738792 15:77979932-77979954 CTCTGTGGCCCCAGCCCCGGGGG - Intergenic
1130254733 15:82320640-82320662 CTCTGTGGCCCCAGCCCCGGGGG - Intergenic
1130600240 15:85269366-85269388 CTCTGTGGCCCCAGCCCCGGGGG + Intergenic
1132808384 16:1786340-1786362 CCCTGCAGCCCCAGACCCGGGGG - Intronic
1141490336 16:84368390-84368412 CGCTGTCCCCAGAGCCCCTGGGG + Intergenic
1147015541 17:37489318-37489340 CCGTGGCGCCCGAGACCCGGAGG - Intergenic
1147150393 17:38510668-38510690 CGCTGTCGCCCGAGACCCGGCGG + Exonic
1155055276 18:22176941-22176963 CGCTGTCGCCGCAGACCTGCTGG + Exonic
1161175909 19:2841953-2841975 CAGAGTCGCCCGAGACCCCGAGG + Intronic
1165077008 19:33285295-33285317 CGGTGTGGCCCGTGACTCGGAGG - Intergenic
926095705 2:10079870-10079892 CGCCGTCCCCCGAGGCCCTGCGG + Intronic
927685528 2:25168245-25168267 CGCTGTCTCCAGGGAGCCGGCGG - Intronic
936370644 2:111899202-111899224 CGCTCTGGCCGGAGTCCCGGGGG + Intronic
1174386443 20:50190706-50190728 CGCGGCCGCCCGAGACCCCCGGG - Intergenic
1175460149 20:59146316-59146338 CGCTCTCTCCCGAAAACCGGTGG - Intergenic
1178710119 21:34909687-34909709 CTCTGTAGCCAGAGACCCGGGGG - Intronic
1184328760 22:43812271-43812293 CGCTGTTGCCCGAGAGACGACGG + Exonic
959530738 3:107431549-107431571 CGCTTCCGCCCGAGCCCCGGCGG - Intergenic
966892465 3:184417344-184417366 CCCTGTCGCCCAAGGCCCAGAGG + Intronic
968097166 3:195940231-195940253 CGGTGTAGCTGGAGACCCGGGGG - Intergenic
972396518 4:38663730-38663752 CGCCGCCGCCCGAGCCCGGGGGG - Intergenic
975584740 4:75939219-75939241 CCCTGTCGCCCCAGCCCTGGTGG + Intronic
982657722 4:158170579-158170601 CGCTGTGGCCCTAGCCCCTGTGG - Exonic
1002029337 5:176416443-176416465 CGCTGTCACCCGAGCCGCGGGGG + Exonic
1006558269 6:34887870-34887892 CGCTGTGCCCGGGGACCCGGGGG - Exonic
1009952498 6:70413478-70413500 CGCAGTCGCCCCAGTCCCGAGGG - Exonic
1012211282 6:96521724-96521746 CGCTTGCGCCCGAGGCGCGGGGG - Intronic
1018167965 6:161117130-161117152 CTCAGTCGCGCGAGACACGGAGG - Exonic
1021221943 7:17984857-17984879 CGCTTGGGCCCGAGAGCCGGAGG - Intergenic
1026944539 7:74307243-74307265 CGCTGTCCCCAGAGGCCAGGGGG + Intronic
1029124492 7:98287196-98287218 CGCTCTCCCCAGAGACCCGGGGG + Intronic
1037811407 8:22089219-22089241 CGCTTTCGCCCGGGAGCCGGGGG + Exonic
1045516500 8:102864484-102864506 CGCAGGCGCCCGAGAGGCGGCGG - Exonic
1055757612 9:79572636-79572658 CCGTGTCACGCGAGACCCGGCGG + Exonic
1057311510 9:93946071-93946093 CGCTGCCGCCCCAGCCCCCGCGG - Intergenic
1062043302 9:134414009-134414031 CGCTGGCGCCGGAGGCCGGGCGG - Intronic
1062105762 9:134753940-134753962 CGCTGCCGCCGGAGAACGGGAGG - Intronic
1189391562 X:40581000-40581022 GGCTGTCGCCCGTGTCCCGCCGG + Exonic