ID: 1147150436

View in Genome Browser
Species Human (GRCh38)
Location 17:38510843-38510865
Sequence CCTGGAGTCCACCAAGGCGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 130}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147150428_1147150436 27 Left 1147150428 17:38510793-38510815 CCTGCGGGCGCGCGGGCGCACAG 0: 1
1: 0
2: 2
3: 11
4: 144
Right 1147150436 17:38510843-38510865 CCTGGAGTCCACCAAGGCGCGGG 0: 1
1: 0
2: 0
3: 10
4: 130
1147150432_1147150436 -10 Left 1147150432 17:38510830-38510852 CCGGACTCAGCAGCCTGGAGTCC 0: 1
1: 0
2: 4
3: 28
4: 302
Right 1147150436 17:38510843-38510865 CCTGGAGTCCACCAAGGCGCGGG 0: 1
1: 0
2: 0
3: 10
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147150436 Original CRISPR CCTGGAGTCCACCAAGGCGC GGG Exonic
900495954 1:2976319-2976341 CCTGGTGTCCACCTGGGTGCTGG + Intergenic
900604411 1:3517357-3517379 ACTGGAGCCCACCAGGGCGGGGG + Intronic
900678979 1:3905787-3905809 CCTGGAGACCACAAGGGCGTCGG - Intergenic
901182250 1:7349887-7349909 CCAGGAGGCCCCCAAGGCCCAGG - Intronic
901238443 1:7679812-7679834 CCTGGGGTCCACCTCGGCCCAGG + Intronic
901804643 1:11730573-11730595 CCTGGACTCCAACAGGGCACAGG + Intergenic
903772267 1:25771465-25771487 CCTGGTTTCCTCCAAGTCGCAGG + Intronic
906306575 1:44723829-44723851 CCTGGATTCCTCCAAGGCGAAGG + Intronic
908671031 1:66547955-66547977 CCTTGAGTTCACCAAGGCCCAGG - Intronic
909532740 1:76699781-76699803 CCTGGAGGGCGCCATGGCGCTGG - Intergenic
909810221 1:79924125-79924147 CATGGAGGCCACCAAGGCTTGGG - Intergenic
912361559 1:109100125-109100147 CCCAGAATCCTCCAAGGCGCGGG + Intergenic
1067066106 10:43105162-43105184 CTTGAACTCCACCACGGCGCTGG - Exonic
1071512320 10:86269825-86269847 CATGGAGTACACCTAGGCGATGG - Intronic
1071553617 10:86585807-86585829 CATGGAGCCCACAAAGGCACTGG - Intergenic
1075723761 10:124601507-124601529 TCTGGAGACCACCAACCCGCTGG + Intronic
1076982085 11:209970-209992 CCTGGACTCCATCAAGGGGGAGG + Exonic
1079924582 11:26478203-26478225 TCTGGAGACCACCAAGCCTCAGG + Intronic
1088686476 11:112288456-112288478 CCTGGAGGCCAAGAAGGAGCTGG + Intergenic
1090402280 11:126456568-126456590 CCTGAAGACCACCAGGGCGGGGG - Intronic
1092246591 12:6867559-6867581 CCTGGAGGGCGCCATGGCGCTGG - Exonic
1099911450 12:88839014-88839036 TCTGGAAGCCACCAAGGCTCAGG + Intergenic
1102346993 12:112166918-112166940 CCTGAGGTCCACCAAGGGGGAGG - Intronic
1103888459 12:124220748-124220770 CCTGGCAGCCACCAAGGCCCAGG - Intronic
1105685432 13:22776384-22776406 CCTGGAGTCCAGCAGGCAGCTGG - Intergenic
1106714526 13:32374017-32374039 CATGGAGGCCACCAAGGCTTAGG + Intronic
1110008130 13:70297467-70297489 CCTGGAGCCCACAATGGTGCAGG - Intergenic
1113849085 13:113407838-113407860 CCTGGAGAAGACCAAGGAGCCGG - Intergenic
1115289266 14:31751917-31751939 CATGGAGGCCACCAAGGCTTGGG + Intronic
1118753065 14:68820374-68820396 TCTGGAGTCCAGCAAGGCAAGGG + Intergenic
1121540824 14:94724932-94724954 ACTAGAGTCCACCAACGTGCTGG + Intergenic
1122140443 14:99660040-99660062 CTGGGAGGCCTCCAAGGCGCAGG - Intronic
1122569207 14:102683493-102683515 CGTGGAGGCCACCTGGGCGCAGG + Intronic
1123007079 14:105329107-105329129 CCTGGAGGCCAGCATGGCCCTGG + Intronic
1202859392 14_GL000225v1_random:72197-72219 CCTGGAGGCCTCCAAGTGGCTGG - Intergenic
1125867835 15:43070300-43070322 CCTAGATACCACCAAGGCACAGG + Intronic
1128157459 15:65400920-65400942 CCTGGCGTCCACCAGGGGGCAGG - Exonic
1129519251 15:76175785-76175807 CCATGAGTCCAACAAGGGGCTGG - Intronic
1129733102 15:77942939-77942961 CCTGGAGTAGACCAAAGAGCAGG - Intergenic
1131460916 15:92616955-92616977 CTTGGAGGTCACCAAGGAGCTGG - Intergenic
1132611020 16:816383-816405 CCTGGAAGCCAACAAGGCACGGG + Intergenic
1132825847 16:1904914-1904936 CCTGAAGTCTCCCAAAGCGCTGG - Intergenic
1133231921 16:4370985-4371007 CCTGGAATCCTCCAAGGCAGGGG + Intronic
1136572688 16:31106076-31106098 CCTGGAGTACAGCCAGGCGGCGG - Intergenic
1137587572 16:49673007-49673029 CCTGGGCTCCAGCAAGGCTCTGG - Intronic
1141627424 16:85268665-85268687 CCTGGAGCCCCCCAAGGGCCTGG + Intergenic
1142285132 16:89168569-89168591 CCGGGAGGCCGCCAGGGCGCTGG - Intergenic
1143305697 17:5945017-5945039 CCTGGATCCCTCCAAAGCGCAGG + Intronic
1143877847 17:10006019-10006041 CCTGGACTCCACTAAGCCACTGG + Intronic
1144298284 17:13899760-13899782 CCTGGGGTCAACCATGGGGCAGG - Intergenic
1144762860 17:17717230-17717252 CCAGGAAGCCACCAAGGGGCTGG - Intronic
1144851822 17:18247656-18247678 CCTCGAGGGCACCGAGGCGCAGG - Exonic
1144966379 17:19079175-19079197 CCTGGAGTCCAGCTGGGCACGGG + Intergenic
1144981539 17:19172882-19172904 CCTGGAGTCCAGCTGGGCACGGG - Intergenic
1144986685 17:19205357-19205379 CCTGGAGTCCAGCTGGGCACGGG + Intergenic
1145759519 17:27418367-27418389 CCTGAAGTCCAACATGGCACAGG - Intergenic
1146588058 17:34100087-34100109 CCTGCAGACCACCAAAGAGCAGG + Intronic
1147150436 17:38510843-38510865 CCTGGAGTCCACCAAGGCGCGGG + Exonic
1148855865 17:50579032-50579054 CCTTCATTCCACCCAGGCGCAGG - Intronic
1149470815 17:56913919-56913941 CCTGGAGCCCTTCAAGGAGCCGG - Exonic
1150867425 17:68868156-68868178 CCTGGAGCTCTCCAAGGAGCAGG - Exonic
1150876433 17:68975986-68976008 CCTGGAGCTCTCCAAGGAGCAGG - Exonic
1152072809 17:78142377-78142399 CCAGGAGTCCAGCCAGGAGCTGG - Exonic
1152472412 17:80497388-80497410 GCTGGAGGCCTCCAAGGTGCTGG + Intergenic
1153514370 18:5890939-5890961 CGAGGAGTCCACGAAGGAGCTGG + Exonic
1160841383 19:1148334-1148356 CCTGGAGTCTCCCAAGGCTCTGG + Intronic
1160933653 19:1582765-1582787 CCTGGAGCCCAGCAAGGACCTGG - Intronic
1161033277 19:2069862-2069884 CCTAGAGGGCACCACGGCGCTGG - Intergenic
1161643915 19:5441361-5441383 ACTGCGGTCCACCCAGGCGCTGG - Intergenic
1163019107 19:14473261-14473283 CCTGGACTCAACCAAGGCCCCGG - Intronic
1164840259 19:31387860-31387882 CCAGGAGGCCACAAAGCCGCAGG - Intergenic
1166856663 19:45785758-45785780 CCTGGACCCCGCCAAGGTGCTGG - Exonic
1166873459 19:45884160-45884182 CCGGGAGTTCATCAAGGCGCAGG - Exonic
1168246944 19:55117253-55117275 GGTGGAGTCCAGCACGGCGCGGG + Exonic
931108326 2:59082401-59082423 CCTGGAATCCACCAGGGAGATGG + Intergenic
934676827 2:96255131-96255153 CCTGCAGACCACCCAGGAGCAGG - Intronic
935217969 2:100989233-100989255 CCTGGAATTCACCAAGACCCAGG + Intronic
940403078 2:153268793-153268815 CCTGGAAGCCACCAAGGCTTGGG + Intergenic
945146550 2:206744259-206744281 CCTGCAGTCCATCAAGAGGCTGG - Intronic
947911958 2:233807464-233807486 CCTGGAGGCCAGCAAGGTGGAGG + Exonic
948562659 2:238864710-238864732 CCTGGGGTCCACCCTGCCGCGGG + Intronic
948606759 2:239140834-239140856 CCTGGAGCCCACGAGGACGCAGG + Intronic
1173603282 20:44311053-44311075 CATGGAGGCCACCAGGGCCCAGG + Exonic
1174170431 20:48614745-48614767 GCTGGATGCCTCCAAGGCGCAGG - Intergenic
1174505958 20:51017744-51017766 CCTGGAGTTCTCCCAGGGGCTGG + Intronic
1179511186 21:41874943-41874965 CCTGGAGTCCTCCAAGCCCGTGG - Intronic
1180940418 22:19657006-19657028 CCTGGTGTCCACCCAGGTCCTGG - Intergenic
1180940908 22:19659054-19659076 CCAGGAGGGCACCAAGGCCCAGG + Intergenic
949917326 3:8975192-8975214 CCTGGAGTCCAGTATGGAGCCGG + Intergenic
949926711 3:9047676-9047698 CCTGGAGCCCTCCAAGGGCCTGG - Intronic
950359542 3:12440837-12440859 CCTGGAGGCCCCCAAGGCCTTGG - Intergenic
950620270 3:14199902-14199924 CCTGGTGTTCACTAAGGCGTGGG + Exonic
951588973 3:24243098-24243120 CCTGGAGTGCACCTGGGCACTGG - Intronic
952152315 3:30606696-30606718 CCTGGAGGCCGGCGAGGCGCGGG - Exonic
953505235 3:43479754-43479776 CCTGGGGTTCTCCAAGGCCCAGG - Intronic
965597507 3:170423048-170423070 CCTGGAATCCACCAAGAAGGAGG + Intronic
966514742 3:180806330-180806352 CCTGGAGTCCGGCCAGGCTCTGG + Intronic
967896114 3:194397256-194397278 CCTGGAGCTCGCCAAGGCCCTGG + Exonic
968741498 4:2333767-2333789 CCTTGTTTCCACCAGGGCGCAGG - Intronic
970375709 4:15455178-15455200 CCTGGCCTCCACCAAGGCCCTGG - Intergenic
979724425 4:123942934-123942956 CCTGGAGCCCAGCGAGGCTCAGG + Intergenic
980050975 4:128040249-128040271 TGGGGAGTCCACCAAGGTGCTGG - Intergenic
984807664 4:183766458-183766480 CCTGGAGGCCACCCAGGCCAGGG + Intergenic
985599294 5:818056-818078 CCTGGAGCCCACGGAGACGCGGG + Intronic
985600061 5:823669-823691 CCTGGAGCCCACGGAGACGCGGG + Intronic
985860374 5:2466020-2466042 CCTGGAGACCTCCCAGACGCAGG + Intergenic
989111028 5:37906844-37906866 CCAGGACACCACCAAGGAGCCGG - Intergenic
999153344 5:149441371-149441393 CCTGGAGGCCACCAGGGTGGAGG + Intergenic
1001593062 5:172879657-172879679 CATGGAGGCCATCAAGGCGGTGG + Intronic
1001982208 5:176045059-176045081 CCTGGTGTCCACGTAGGTGCTGG + Intergenic
1002235253 5:177798998-177799020 CCTGGTGTCCACGTAGGTGCTGG - Intergenic
1002980113 6:2127733-2127755 CCTGGAGTCCCCCAGGGGCCTGG - Intronic
1006963245 6:37955662-37955684 CTTGGAGTACACCAAAGCACTGG - Intronic
1007114884 6:39336345-39336367 CCTGGAGGCCACCGAGAGGCTGG - Exonic
1007254738 6:40520781-40520803 CATGGAGACCACGAAGGGGCTGG - Intronic
1011526100 6:88266579-88266601 CCTGGAGTGCTCCCAGGGGCTGG + Intergenic
1013972497 6:116038748-116038770 CCTGGAGGTCGCCATGGCGCTGG - Intronic
1017907810 6:158768871-158768893 CCTGGAGACGTCCAAGGAGCTGG + Intronic
1018811325 6:167300379-167300401 CCTGGTGTCCTCCAAGACCCTGG - Intronic
1019701828 7:2477873-2477895 CCTGGGGCCCAGCAAGCCGCAGG + Intergenic
1022120440 7:27303054-27303076 CCTGGAATCCACCCAAGGGCTGG - Intergenic
1023990893 7:45127613-45127635 CCTGGACTCCACCAGGTCTCTGG - Intergenic
1024236806 7:47404989-47405011 CCTGGAGTACACCAAGTCGAAGG + Intronic
1026879898 7:73901595-73901617 GCTGGAGTTCTCCAAGGCCCTGG + Intergenic
1032097742 7:128947823-128947845 GCTGGAGGCCACCCAGGAGCAGG + Exonic
1032108619 7:129056011-129056033 CCTGGAGGGCGCCATGGCGCTGG - Intergenic
1034639102 7:152588448-152588470 CCTCAAGTCTCCCAAGGCGCTGG - Intergenic
1035019732 7:155793879-155793901 CTTGGCCTCCACCAAGGAGCAGG - Intergenic
1035700420 8:1634515-1634537 CCAGGACTTCACCAAGGGGCAGG - Intronic
1036705441 8:11042981-11043003 CCTGGGGTCCACCACTGCCCTGG - Intronic
1038263985 8:26022696-26022718 CCTCGAGACCACCAAGGAGCTGG - Intronic
1041201209 8:55453068-55453090 CCTGGAGCCCACCGAGGATCAGG - Intronic
1044518989 8:93176218-93176240 GCTGGAGGCCACCAAGGAGCTGG + Intergenic
1048218943 8:132523839-132523861 CTGGGAGTCCACCAAGCCTCTGG - Intergenic
1049681313 8:143919716-143919738 CCTGGAGGACACCAAGGAGAAGG - Exonic
1052603822 9:30672396-30672418 CCTGGTGTCCACCAGGGACCTGG + Intergenic
1061026891 9:128055539-128055561 CCTGGAGGCTACCCAGGAGCTGG + Intergenic
1062381806 9:136290390-136290412 CCTGGAGGACACCAGGGGGCTGG + Intronic
1203784139 EBV:117720-117742 CTTGGTGTGCACGAAGGCGCAGG - Intergenic
1199620710 X:149697797-149697819 CCTGGAAACCACCAAGGCTTGGG - Intronic
1199713087 X:150486088-150486110 CCTGAAGTCCACCCAACCGCTGG - Intronic