ID: 1147150656

View in Genome Browser
Species Human (GRCh38)
Location 17:38511721-38511743
Sequence CCTGTTCCCCAGACAGTTTT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 172}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147150652_1147150656 6 Left 1147150652 17:38511692-38511714 CCTCTAAGCGCTTTAACCACGGG 0: 1
1: 0
2: 0
3: 3
4: 14
Right 1147150656 17:38511721-38511743 CCTGTTCCCCAGACAGTTTTTGG 0: 1
1: 0
2: 0
3: 14
4: 172
1147150647_1147150656 30 Left 1147150647 17:38511668-38511690 CCAACATCCTTTTGCCTGAGTCA 0: 1
1: 0
2: 1
3: 14
4: 185
Right 1147150656 17:38511721-38511743 CCTGTTCCCCAGACAGTTTTTGG 0: 1
1: 0
2: 0
3: 14
4: 172
1147150654_1147150656 -10 Left 1147150654 17:38511708-38511730 CCACGGGCAGCTGCCTGTTCCCC 0: 1
1: 0
2: 0
3: 31
4: 288
Right 1147150656 17:38511721-38511743 CCTGTTCCCCAGACAGTTTTTGG 0: 1
1: 0
2: 0
3: 14
4: 172
1147150649_1147150656 16 Left 1147150649 17:38511682-38511704 CCTGAGTCACCCTCTAAGCGCTT 0: 1
1: 0
2: 1
3: 5
4: 46
Right 1147150656 17:38511721-38511743 CCTGTTCCCCAGACAGTTTTTGG 0: 1
1: 0
2: 0
3: 14
4: 172
1147150650_1147150656 7 Left 1147150650 17:38511691-38511713 CCCTCTAAGCGCTTTAACCACGG 0: 1
1: 0
2: 0
3: 1
4: 13
Right 1147150656 17:38511721-38511743 CCTGTTCCCCAGACAGTTTTTGG 0: 1
1: 0
2: 0
3: 14
4: 172
1147150648_1147150656 23 Left 1147150648 17:38511675-38511697 CCTTTTGCCTGAGTCACCCTCTA 0: 1
1: 0
2: 2
3: 13
4: 184
Right 1147150656 17:38511721-38511743 CCTGTTCCCCAGACAGTTTTTGG 0: 1
1: 0
2: 0
3: 14
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147150656 Original CRISPR CCTGTTCCCCAGACAGTTTT TGG Exonic
901579951 1:10234068-10234090 CCTATTCCCTAGAAAGGTTTTGG - Intronic
901591110 1:10343909-10343931 CCTAGTCCCCTGACAGTTATGGG - Intronic
903799070 1:25953223-25953245 CTCGTTCCCCAGACAGACTTGGG - Intergenic
906287540 1:44597341-44597363 CCTTTTCCCCCCAAAGTTTTTGG - Intronic
906562658 1:46770518-46770540 CCTTTTCCCCTGACACTTTCAGG + Intronic
908363932 1:63398205-63398227 CCTGTTCCCTAGTCAGAGTTTGG + Intronic
910940595 1:92529501-92529523 CTTGTTCCCCATAGATTTTTAGG - Intronic
913314123 1:117535777-117535799 CCAGTGCCTCACACAGTTTTTGG - Intergenic
915322779 1:155064877-155064899 CCTGTTCTCCAGAGAGTCTGTGG - Intronic
916972968 1:170043962-170043984 CATCATCCCCAGGCAGTTTTTGG - Intronic
917315045 1:173715346-173715368 CAGCTTCCCCAGACAGTGTTTGG + Intronic
919360878 1:196592939-196592961 CCTGTTCCCCCCACATTTTATGG - Intronic
922188981 1:223300324-223300346 CCTGTTACTCACACAGTTTTTGG - Intronic
922480796 1:225939278-225939300 CCGGTCCCCCAGACAGTCCTGGG + Intronic
922556753 1:226538449-226538471 CCAGTTCCTCAGAGGGTTTTGGG - Intergenic
923199654 1:231699045-231699067 CATGTTCCACAGAGATTTTTGGG + Intronic
924387192 1:243509888-243509910 CCTGTGCCCCTTACAGTTCTGGG - Intronic
1064360378 10:14659054-14659076 CCTGGTCCCCAGACTCTTTATGG - Intronic
1064376141 10:14797945-14797967 TCTCTTCCACAGACAGTATTGGG + Intergenic
1066125895 10:32342685-32342707 CCTGTTACCTAGACTGGTTTGGG - Intronic
1066162215 10:32746252-32746274 CTTGGTCCCCAGAAATTTTTGGG + Intronic
1067280203 10:44865313-44865335 CCTACTACCCAGACAGTTTCCGG + Intergenic
1068367636 10:56071226-56071248 CCTGTTCCACAGACAATTTCTGG + Intergenic
1068397124 10:56477383-56477405 CCTGTTCCCGAGACACACTTAGG + Intergenic
1069025771 10:63539297-63539319 CCTGTTTATCAGAAAGTTTTAGG - Intronic
1069457047 10:68561304-68561326 CCTGTCTCCCCGAGAGTTTTGGG + Intronic
1075662297 10:124206385-124206407 CCTGTTCTCCAGTAAATTTTTGG - Intergenic
1090071267 11:123546581-123546603 CCTGTTCCCCAGTGAGGTCTGGG + Intronic
1090270261 11:125380975-125380997 GCTGTTCCCAACACAGTTATGGG - Intronic
1090409472 11:126497917-126497939 TCTGATCCCCAGAGAGTTTGTGG + Intronic
1091629697 12:2150372-2150394 CCTGTTCCCCAGGGAATGTTGGG - Intronic
1092659705 12:10724192-10724214 CCTGTATTCCAGACAGTCTTTGG - Intergenic
1095430017 12:42123084-42123106 ACTGTTCCCCAGCCTTTTTTGGG - Intronic
1096838716 12:54368433-54368455 CCTGTTCCACAGACCATTTAGGG + Intergenic
1099326599 12:81223783-81223805 CCTGTTCCCTAGAGAGATCTGGG - Intronic
1099712977 12:86251354-86251376 CCTATTTCCCATAAAGTTTTTGG + Intronic
1099713063 12:86253105-86253127 CCTATTTCCCATAAAGTTTTTGG + Intronic
1113376873 13:109772308-109772330 CCTTTTCCCCAGCAAGGTTTGGG - Intronic
1114843568 14:26294187-26294209 CCTGATCCCCTGAGAGGTTTTGG - Intergenic
1116351477 14:43869081-43869103 ACTGCTCACCAGACAGGTTTAGG - Intergenic
1116780361 14:49230293-49230315 CCTCTTCCCAATACAGTTTTTGG + Intergenic
1119541840 14:75444103-75444125 CATGTTGCCCAGGCTGTTTTTGG + Intronic
1119726447 14:76924533-76924555 CCTGGCCCCCAAACAGTTTTTGG + Intergenic
1123495752 15:20823721-20823743 CCTGTTCCACAGTTAGCTTTCGG - Intergenic
1123552238 15:21392813-21392835 CCTGTTCCACAGTTAGCTTTCGG - Intergenic
1123588482 15:21830210-21830232 CCTGTTCCACAGTTAGCTTTCGG - Intergenic
1131302841 15:91214764-91214786 AGTGTTCCCCAAACAGTTGTGGG + Intronic
1202960586 15_KI270727v1_random:120046-120068 CCTGTTCCACAGTTAGCTTTCGG - Intergenic
1134016165 16:10889980-10890002 CCTTTTCCCCAGAGCTTTTTGGG + Intronic
1135051547 16:19196974-19196996 TCTGTTTACCAGGCAGTTTTTGG - Intronic
1135342853 16:21663974-21663996 CCTGCTCCCCAGCCACTCTTCGG - Intergenic
1135999005 16:27276217-27276239 CCTGGTCCCCACATATTTTTTGG - Intronic
1137810046 16:51343998-51344020 CCTGTTCTCCAGACATTCGTTGG - Intergenic
1139126788 16:64088234-64088256 CCTGCCCCCATGACAGTTTTGGG + Intergenic
1139468339 16:67165707-67165729 CCCACTCCCCAGACGGTTTTCGG + Exonic
1140032675 16:71350961-71350983 CGTGTTTCCCAGACAGTCTCGGG + Intergenic
1140674005 16:77308630-77308652 CCTGTTTCATACACAGTTTTAGG - Intronic
1140986041 16:80158909-80158931 TCTGCTCCCCAGACACTTTCTGG - Intergenic
1142025803 16:87812869-87812891 GCTGCTCCCAAGACAGTCTTTGG + Intergenic
1143474442 17:7194622-7194644 TTTGGTCCCCACACAGTTTTGGG - Intronic
1145721542 17:27077683-27077705 CCTGTTTTCCAGCCAGCTTTGGG - Intergenic
1146792283 17:35758801-35758823 CCTCTTCCCAAGGCTGTTTTGGG - Intronic
1147150656 17:38511721-38511743 CCTGTTCCCCAGACAGTTTTTGG + Exonic
1147353953 17:39876117-39876139 CCTGTTGCCCAGACTGGTCTTGG + Intronic
1148209719 17:45800825-45800847 CCTGTTCCCCAGGAACTTGTAGG + Intronic
1148992730 17:51680568-51680590 CCTGTTCCCCAGGGAGTGTTTGG + Intronic
1149561220 17:57609194-57609216 CCTCTTCCCCAGCCAGGTTCTGG - Intronic
1150305575 17:64082248-64082270 CCTGTTTCCTAGAGTGTTTTTGG - Intronic
1153119846 18:1708751-1708773 CCTGTTACAAAGAAAGTTTTTGG + Intergenic
1154138509 18:11802053-11802075 CCTGTTTCCCTGAAAGTTTAGGG + Intronic
1154453149 18:14496181-14496203 CCTGTTCCACAGTTAGCTTTCGG - Intergenic
1155817616 18:30333759-30333781 CCTGTTTCCCAGACATTCTCTGG - Intergenic
1161627606 19:5336335-5336357 CCTGTTTCCTAGACATTTTGGGG + Intronic
1163082590 19:14954432-14954454 CCTGTTCCCCAGCCTTTCTTCGG - Intronic
1163600862 19:18248289-18248311 CCTGGTGCCCAGACAGTTAAGGG - Intronic
1164948470 19:32316039-32316061 GCTGTTCCCGTGAAAGTTTTTGG - Intergenic
1166205225 19:41264927-41264949 CCTGGTCCCCAGATCCTTTTCGG - Intronic
1167747447 19:51360632-51360654 ACAGTTCCCAAGACAGATTTGGG - Intronic
1168008073 19:53507318-53507340 CCTGTCCCACAGACAGCTTGGGG + Intergenic
1168044968 19:53788035-53788057 CCTGTACCCAAGACAGTTTCCGG - Intergenic
925295721 2:2775387-2775409 GCTGATCCCCAGACAGTGTATGG + Intergenic
926083009 2:10004028-10004050 CATCTTCCCCAGACAGCGTTAGG + Intergenic
931275514 2:60740519-60740541 CCTGTCCCCAGGACTGTTTTAGG + Intergenic
931466019 2:62487574-62487596 CCTGTTTCACAGGCATTTTTAGG - Intergenic
932407415 2:71522770-71522792 CCTGTTCCCCATCCCGTATTAGG + Intronic
932952694 2:76312929-76312951 CCCTTACCCCAGTCAGTTTTGGG + Intergenic
933772908 2:85755078-85755100 CCTGGTGCCCAGACAGGTGTGGG + Intronic
937205085 2:120231201-120231223 CATGTTGCCCAGACTCTTTTAGG - Intergenic
939566126 2:143788520-143788542 ACTGTTTCCCAGTCATTTTTTGG - Intergenic
940125784 2:150322553-150322575 CCTGTTCCCCAAAAACTTATAGG - Intergenic
941425239 2:165336188-165336210 GCTGTTCCCCAAAAAGTTTGGGG + Intronic
942658445 2:178239120-178239142 CCAGTTCCCCAAACATTTTTTGG + Intronic
945150640 2:206786721-206786743 TTTGTTCCCCAGACAGTTCGTGG + Exonic
945514047 2:210740184-210740206 CCTCTTCTTCAGACAGTTTGGGG + Intergenic
946381803 2:219353761-219353783 CCTGTACCCCAGTCAGTCTCCGG - Intergenic
947054339 2:226084138-226084160 CCTGTTCCAAAGACAGTAATTGG + Intergenic
948383955 2:237570111-237570133 CCTGTTTCCCAGCCAGCTTGCGG + Intergenic
1170011176 20:11725743-11725765 CCTGTGCCTCAGACAGTGCTTGG + Intergenic
1170974846 20:21152592-21152614 GCTGTTACCTTGACAGTTTTAGG + Intronic
1171101168 20:22384999-22385021 CCTGGTACCCAGAAAGTTCTTGG - Intergenic
1171980268 20:31623121-31623143 CCTGTTAGCCAGACAGTGTGAGG + Intergenic
1176442880 21:6792094-6792116 CCTGTTCCACAGTTAGCTTTCGG + Intergenic
1176821035 21:13657096-13657118 CCTGTTCCACAGTTAGCTTTCGG + Intergenic
1178686639 21:34716787-34716809 CATGTTCTCCAGTAAGTTTTCGG - Exonic
1178881907 21:36456483-36456505 CCTTTTTCCCAGGCAGTTTCTGG - Intergenic
1179018572 21:37616840-37616862 CCTGGTGCCCACACAGCTTTCGG - Exonic
1179124185 21:38576915-38576937 CCTGGTCCCCAGCCAGTCTCTGG + Intronic
1180713273 22:17854509-17854531 CCTGTTCACCAGGCAGTTCTCGG - Intronic
1182672559 22:32009231-32009253 CCTTTTCCTCATACAGTTCTTGG - Intergenic
1183075617 22:35424772-35424794 CCTGTTCCCCAGTAACTTATTGG + Exonic
1184539630 22:45112113-45112135 CCAGCTTCCCAGCCAGTTTTTGG + Intergenic
1184701801 22:46179740-46179762 ACTGTTCAAAAGACAGTTTTAGG + Intronic
949312361 3:2714135-2714157 CCTGTTGGCCAGGCAGTGTTGGG + Intronic
949892500 3:8743757-8743779 CATGTTGCTCAGACAGTGTTGGG - Intronic
950191333 3:10978459-10978481 CCTGTTTCTCTGGCAGTTTTGGG - Intergenic
950454479 3:13084442-13084464 ACTGTGTGCCAGACAGTTTTAGG + Intergenic
954692729 3:52404278-52404300 CCAGGTCCCCAGGAAGTTTTTGG - Intronic
955751887 3:62191757-62191779 CATGTTCACCAGACAGTGTGAGG - Intronic
956284313 3:67592606-67592628 CCTATTCCCCAGACTATTTGGGG - Intronic
956971919 3:74536474-74536496 CCACTTCCCAAGACAGATTTAGG + Intergenic
959604708 3:108229697-108229719 CCTGTTTCACAGATAGTTATTGG + Intergenic
961053750 3:123768800-123768822 CCTGTTCACCAGACAGTGTATGG - Intronic
962030080 3:131590273-131590295 CCTGCTCCCCATTCAGTTCTTGG - Intronic
962676297 3:137760971-137760993 CCTGTTCCCCAGCCTCTTTTGGG - Intergenic
965443848 3:168750091-168750113 CCTGTGCCCCGTACAGTTTCAGG - Intergenic
967892063 3:194370570-194370592 CCTCTTCCCCAGGCCTTTTTGGG - Intergenic
970111142 4:12639382-12639404 TTTGTTCCACAGATAGTTTTCGG - Intergenic
973566539 4:52194458-52194480 CCTCTTCCCCAAACATATTTTGG - Intergenic
974186417 4:58453383-58453405 CATGTTGCCCAGACAGGTCTTGG + Intergenic
975058325 4:69963819-69963841 CCTGGTCCCTAGACAGTGTCTGG - Intergenic
976120607 4:81776760-81776782 GCTGTGCCTCATACAGTTTTGGG - Intronic
978902219 4:113965231-113965253 ATTGTTTCCCATACAGTTTTGGG - Intronic
979608288 4:122662832-122662854 CCTCTTCCCTAGACTATTTTTGG + Intergenic
981405374 4:144361412-144361434 CCTGTGCCCCAGACTCATTTGGG + Intergenic
983235545 4:165175314-165175336 CCTTTTCCCCAAACACTATTGGG - Intronic
984793797 4:183638908-183638930 CCTGTTCCCCTAAGATTTTTGGG + Intergenic
990074307 5:51824298-51824320 ACAGTTCTCCAGACAGTTTCAGG - Intergenic
991027004 5:62040640-62040662 CCTGTGCCTCACAAAGTTTTGGG - Intergenic
1001071723 5:168591264-168591286 GCTGATCCCCAGACTGCTTTTGG + Intergenic
1001135019 5:169095393-169095415 CCAATTGCCCAGTCAGTTTTAGG + Intronic
1001980552 5:176034902-176034924 CCTGCTCCCCAGGGAGTGTTGGG - Intergenic
1007866519 6:44975704-44975726 CCTGTTCCTCAAACACTATTGGG + Intronic
1007987054 6:46217350-46217372 ACTGTTCCCCAAACAATCTTTGG - Intergenic
1008086876 6:47254573-47254595 CCTTTTACCTAGACAGTTCTGGG - Intronic
1009302845 6:62048858-62048880 TATGTTCCCAAGATAGTTTTTGG - Intronic
1010570317 6:77466389-77466411 TTTGTTCCCCACACGGTTTTTGG + Intergenic
1011045342 6:83075752-83075774 CCTCTTCACCAGATAGTGTTGGG + Intronic
1014511479 6:122327913-122327935 CTTGTTACACACACAGTTTTAGG - Intergenic
1015346912 6:132171116-132171138 CCTGCTCCCCACACAGTATTGGG + Intergenic
1016919603 6:149278875-149278897 CGTGTTGCCCAGACAGGTCTCGG - Intronic
1017240754 6:152165705-152165727 CCTGTCCCCCAGACACTTCAAGG + Intronic
1018927864 6:168219384-168219406 CCAGGTCCCCAGACTGTATTTGG - Intergenic
1023448458 7:40256209-40256231 TCTTTTCCCCTGACATTTTTGGG + Intronic
1024669962 7:51585320-51585342 CCTGTTTCCCATTCAGTTATTGG + Intergenic
1026476893 7:70744092-70744114 CCTGTTTCCCAGGAACTTTTTGG - Intronic
1026904480 7:74055038-74055060 CCACATCCCCAGGCAGTTTTGGG - Intronic
1028164574 7:87523325-87523347 TCTGTTTTCCAGAAAGTTTTGGG + Intronic
1028328779 7:89561708-89561730 GCTTTTCCCCAGACCGTCTTGGG - Intergenic
1032816607 7:135482352-135482374 CATGTTGCCCAGGCTGTTTTTGG - Intronic
1033429402 7:141275235-141275257 CCAGTTCCCAAGACAGTGCTGGG - Intronic
1036918822 8:12832209-12832231 CTTGTTCCCACGACACTTTTAGG - Intergenic
1037521207 8:19682040-19682062 CCTGTACCACAGAAAGATTTTGG + Intronic
1037693168 8:21200646-21200668 CCTGTTCCCCAAAAACTATTGGG + Intergenic
1039249989 8:35652452-35652474 CGTGTTCCCAAAACAGTTATAGG + Intronic
1045959362 8:107949027-107949049 CCTGTTCCCCAAAAACTATTAGG - Intronic
1051708005 9:19900808-19900830 CCAGTTCCACTGACAATTTTGGG + Intergenic
1054872408 9:70060223-70060245 CCTGTGCCCAACACAGTGTTTGG + Intronic
1056719755 9:89061504-89061526 CCTGTTCTCCAGAAAATCTTGGG + Intronic
1057025952 9:91733868-91733890 CCTTCTCCCCAGACAGATCTGGG - Intronic
1057305465 9:93909798-93909820 GCTGTGCCCAAAACAGTTTTGGG - Intergenic
1058545314 9:106054876-106054898 CCTGTGCACCAGTCAGTTTTTGG + Intergenic
1060023924 9:120155328-120155350 CCTATTGCCCATTCAGTTTTGGG - Intergenic
1060238830 9:121886027-121886049 CCTGTTCCTAAGAAAGTTATAGG - Intronic
1060907899 9:127324389-127324411 GCTCTTCCCCAGAGAGTCTTGGG + Intronic
1061715403 9:132515539-132515561 CCTGGGCCCAAGACACTTTTAGG - Intronic
1062372963 9:136249524-136249546 CCAGCTCCCCAGGCAGCTTTGGG - Intergenic
1062733866 9:138123976-138123998 CCATTTCCCCAGGCAGTGTTGGG + Exonic
1203526324 Un_GL000213v1:92439-92461 CCTGTTCCACAGTTAGCTTTCGG - Intergenic
1186315759 X:8368472-8368494 CCTCTTTCCCAGCCAATTTTTGG - Intergenic
1188220164 X:27531615-27531637 TCTATTTCTCAGACAGTTTTTGG - Intergenic
1188264262 X:28051515-28051537 ACTGTTCCCTAGACAGTGCTTGG + Intergenic
1188665405 X:32813420-32813442 CATGTTAGCCAAACAGTTTTAGG + Intronic
1190469664 X:50765713-50765735 TCTGTTTGCCAGACAGTTTACGG - Intronic
1191892599 X:65960059-65960081 CCTGTTCTTCAGTCAGTTTTTGG - Intergenic
1195285592 X:103379523-103379545 CCTTTTCTCCAGACAGTTTCTGG + Intergenic
1199896289 X:152130687-152130709 CCTCTACCCCAGACAGTGTCTGG + Intergenic
1201620740 Y:15954523-15954545 CATTTTCCCCAGCCAGGTTTTGG - Intergenic