ID: 1147152871

View in Genome Browser
Species Human (GRCh38)
Location 17:38528386-38528408
Sequence CCTTCCAGGCGTGCAGCGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147152865_1147152871 15 Left 1147152865 17:38528348-38528370 CCTGGATAGGCATCTGGCGGGTG No data
Right 1147152871 17:38528386-38528408 CCTTCCAGGCGTGCAGCGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147152871 Original CRISPR CCTTCCAGGCGTGCAGCGGA TGG Intergenic
No off target data available for this crispr