ID: 1147153310

View in Genome Browser
Species Human (GRCh38)
Location 17:38530973-38530995
Sequence TTCCTGCACATTTATGGGCT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 3, 1: 2, 2: 0, 3: 7, 4: 162}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147153310_1147153321 28 Left 1147153310 17:38530973-38530995 CCCAGCCCATAAATGTGCAGGAA 0: 3
1: 2
2: 0
3: 7
4: 162
Right 1147153321 17:38531024-38531046 CTGGGCTTCACCCGAGCGGGTGG 0: 1
1: 1
2: 5
3: 5
4: 92
1147153310_1147153320 25 Left 1147153310 17:38530973-38530995 CCCAGCCCATAAATGTGCAGGAA 0: 3
1: 2
2: 0
3: 7
4: 162
Right 1147153320 17:38531021-38531043 CCACTGGGCTTCACCCGAGCGGG 0: 1
1: 2
2: 2
3: 8
4: 104
1147153310_1147153318 24 Left 1147153310 17:38530973-38530995 CCCAGCCCATAAATGTGCAGGAA 0: 3
1: 2
2: 0
3: 7
4: 162
Right 1147153318 17:38531020-38531042 CCCACTGGGCTTCACCCGAGCGG 0: 1
1: 3
2: 0
3: 9
4: 96
1147153310_1147153315 9 Left 1147153310 17:38530973-38530995 CCCAGCCCATAAATGTGCAGGAA 0: 3
1: 2
2: 0
3: 7
4: 162
Right 1147153315 17:38531005-38531027 AAGAAAGATGCAAATCCCACTGG 0: 5
1: 0
2: 0
3: 25
4: 267
1147153310_1147153322 29 Left 1147153310 17:38530973-38530995 CCCAGCCCATAAATGTGCAGGAA 0: 3
1: 2
2: 0
3: 7
4: 162
Right 1147153322 17:38531025-38531047 TGGGCTTCACCCGAGCGGGTGGG 0: 1
1: 1
2: 3
3: 12
4: 56
1147153310_1147153323 30 Left 1147153310 17:38530973-38530995 CCCAGCCCATAAATGTGCAGGAA 0: 3
1: 2
2: 0
3: 7
4: 162
Right 1147153323 17:38531026-38531048 GGGCTTCACCCGAGCGGGTGGGG 0: 1
1: 1
2: 9
3: 10
4: 87
1147153310_1147153316 10 Left 1147153310 17:38530973-38530995 CCCAGCCCATAAATGTGCAGGAA 0: 3
1: 2
2: 0
3: 7
4: 162
Right 1147153316 17:38531006-38531028 AGAAAGATGCAAATCCCACTGGG 0: 5
1: 0
2: 1
3: 14
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147153310 Original CRISPR TTCCTGCACATTTATGGGCT GGG (reversed) Exonic
902991820 1:20193107-20193129 TTCCTGTACTTTTAGGTGCTGGG - Exonic
905308726 1:37035278-37035300 TTCCTGCACAGTTACGGGAGAGG - Intergenic
905474813 1:38218540-38218562 TTCCTGCACAGTTCTGGGTTAGG - Intergenic
905701219 1:40016626-40016648 TTCATGAACTTTTATGGACTTGG + Intergenic
906798776 1:48718413-48718435 TTCATGCACTTTTCTGAGCTAGG - Intronic
907846702 1:58215040-58215062 TTTCTGCAGATGTATGGGCAAGG - Intronic
908335113 1:63114773-63114795 TTCCTGCACAGTGCTGGGCATGG - Intergenic
908516637 1:64898797-64898819 TCCCTGAACATTTCTGGGCCTGG + Intronic
908802046 1:67890363-67890385 TTACTGCACTTGTTTGGGCTTGG + Intergenic
909207346 1:72776177-72776199 TTCCTGTACTTTTAAGGCCTTGG + Intergenic
911103347 1:94111019-94111041 TTCTTGGACATCTAAGGGCTAGG - Intronic
914472839 1:147997999-147998021 TTTCTTCACATGGATGGGCTGGG - Intergenic
916461670 1:165031114-165031136 TTCATGCACATGTGTGGCCTTGG + Intergenic
921446840 1:215256657-215256679 ATCCTGCAAATATAGGGGCTGGG + Intergenic
923142338 1:231171257-231171279 TTCCTGCCCATCTCTGGGCCAGG - Intronic
923457422 1:234176479-234176501 GTCCTACACATTTATGGGTGAGG - Intronic
1065486262 10:26239030-26239052 TTCCAGCTCATTGATAGGCTGGG + Intronic
1066749711 10:38641347-38641369 TTCCTCCACATATATTTGCTAGG - Intergenic
1066966936 10:42276431-42276453 TTCCTCCACATATATTTGCTAGG + Intergenic
1071041862 10:81319215-81319237 TTCCTCCTCATATATGGACTTGG + Intergenic
1072828091 10:98628762-98628784 TTCCTTCATATTTCAGGGCTGGG + Intronic
1075006733 10:118835975-118835997 TTTCTGGAAATTGATGGGCTAGG + Intergenic
1075199508 10:120390463-120390485 TTCATGCAAATTGATTGGCTAGG + Intergenic
1077846190 11:6027329-6027351 GTCCTGCACGTTTATGGTCATGG - Exonic
1077848009 11:6046384-6046406 GTCCTGCACATTCATGGTCAAGG - Intergenic
1079518798 11:21300412-21300434 TTTATTCACATTTCTGGGCTAGG + Intronic
1080023559 11:27590118-27590140 TTCCTGACCACTTATGGCCTAGG - Intergenic
1086770336 11:90755417-90755439 ATCCTGCAAATTAATTGGCTAGG + Intergenic
1087157210 11:94917123-94917145 TTGCTACACATTTATGTGTTTGG - Intergenic
1087917746 11:103830535-103830557 TTCCTGAAAGTTTATGGGCTGGG + Intergenic
1095194498 12:39297137-39297159 TTCCTTGACATTTCTGTGCTTGG - Intronic
1095380991 12:41591742-41591764 TTCATGCACATTTCTGGGTCTGG - Intergenic
1096534129 12:52259988-52260010 TTTCTGCACTCTCATGGGCTTGG + Intronic
1096783800 12:54005833-54005855 TTCAGGCGCATTTCTGGGCTTGG - Intronic
1097376721 12:58852089-58852111 TTCCTGCACAGCTATGTGCCCGG - Intergenic
1100073002 12:90744224-90744246 TTATTGAACACTTATGGGCTAGG - Intergenic
1103848855 12:123918150-123918172 TTTCTGTCCATTTCTGGGCTGGG + Intronic
1104196651 12:126546441-126546463 TTCCTAGAGATTTATGGGGTTGG + Intergenic
1104734847 12:131130527-131130549 CTCCTGCTGATTCATGGGCTCGG + Intronic
1115115287 14:29873708-29873730 TTCTTGCCCATTTCTGGGATGGG - Intronic
1115206948 14:30918065-30918087 TTCCTACACATTTCTGGTTTAGG + Intronic
1120510260 14:85404786-85404808 TTCCTAGACATGTATGAGCTGGG - Intergenic
1122251066 14:100440266-100440288 TTCCTGCACATTCATTTGCCAGG - Intronic
1124651901 15:31480293-31480315 TTCCTGCACATTTGTTATCTGGG - Exonic
1125875339 15:43139236-43139258 TTCCTGGACTTATATGGGCAAGG - Intronic
1126691057 15:51289364-51289386 TCCCTGCACAATTCTGGGCATGG + Intronic
1129149132 15:73676601-73676623 TTCCTGTACATTAAGGGGTTGGG + Intergenic
1133195133 16:4164253-4164275 TTAATGCACATTTATGTACTTGG - Intergenic
1133437830 16:5795169-5795191 TTTCTTGACATTTATGGGTTAGG - Intergenic
1134366829 16:13586632-13586654 TTCGCCCACTTTTATGGGCTGGG + Intergenic
1136690449 16:32024838-32024860 TTCCTGCACATTTATGGGCCGGG - Intergenic
1136733006 16:32435805-32435827 TTCCTCCACATATATTTGCTAGG + Intergenic
1136791037 16:32968398-32968420 TTCCTGCACATTTATGGGCTGGG - Intergenic
1136878776 16:33885534-33885556 TTCCTGCACATTTATGGGCTGGG + Intergenic
1138925439 16:61584747-61584769 TGCTTGCTCATTTATGTGCTAGG + Intergenic
1139015404 16:62683953-62683975 TCCCTGCACTTTCATGGGCCAGG + Intergenic
1140232359 16:73127822-73127844 TTCCTGAACTTTTATGCCCTCGG + Intronic
1141477983 16:84286630-84286652 TTCCTGCAGATCTGTGGGCGAGG - Intergenic
1141873462 16:86805687-86805709 GTCCTGGACATTTATGCTCTAGG + Intergenic
1203020075 16_KI270728v1_random:393798-393820 TTCCTCCACATATATTTGCTAGG - Intergenic
1203038410 16_KI270728v1_random:666956-666978 TTCCTCCACATATATTTGCTAGG - Intergenic
1203093245 16_KI270728v1_random:1229859-1229881 TTCCTGCACATTTATGGGCCGGG - Intergenic
1143541374 17:7571501-7571523 TCCCTTCCCATTTATGGGCTTGG - Exonic
1147153310 17:38530973-38530995 TTCCTGCACATTTATGGGCTGGG - Exonic
1147426576 17:40348633-40348655 GCCCTGCACATTTATGGGGGAGG - Intronic
1149626173 17:58082675-58082697 TCCTTGCACATTTATGGCCTTGG - Intergenic
1151020279 17:70608204-70608226 TTCATGCACATTGACTGGCTTGG - Intergenic
1152518489 17:80840187-80840209 TTCCTGCCCAGTTTTGTGCTTGG + Intronic
1153444878 18:5160067-5160089 TTCCTGCACATGTGTAGGCAAGG - Intronic
1158557990 18:58490911-58490933 TTCCTGCATATTCATGGGGATGG - Intronic
928154453 2:28863513-28863535 TTCTTGCACATTTATAGTTTAGG + Intronic
928949960 2:36805745-36805767 TTCATGCACATTTAAAGGCATGG - Intronic
929044120 2:37773958-37773980 TTCCTGGAGATTTCTGGGCAGGG - Intergenic
937153282 2:119700778-119700800 TTCCTGCAGATTTCTGTCCTAGG + Intergenic
938343488 2:130550120-130550142 TTACTGTATATTTCTGGGCTTGG - Intergenic
938346345 2:130570602-130570624 TTACTGTATATTTCTGGGCTTGG + Intergenic
938705920 2:133926649-133926671 TTTATGCATATTTATGGGGTAGG - Intergenic
941995628 2:171599593-171599615 TCCCTGCTCAGTTATCGGCTGGG - Intergenic
946278850 2:218651603-218651625 TTCATGTACATTCATGGCCTTGG + Intronic
947958986 2:234218782-234218804 TTCCTGCACAGGCCTGGGCTGGG + Intergenic
948538152 2:238663479-238663501 ATCTTGCTCAGTTATGGGCTTGG + Intergenic
1168911831 20:1454320-1454342 TTCATACACATTTAAGGGGTTGG + Intronic
1171027154 20:21641140-21641162 TCCCCGCACCTTTCTGGGCTTGG - Intergenic
1172510916 20:35500472-35500494 CTCCTGCACAATTATAGGATTGG + Intronic
1173060680 20:39657130-39657152 TTCCAAAACATTTATGGGCTGGG - Intergenic
1175048179 20:56126922-56126944 TTCCTGCATGTTTATGGCTTTGG - Intergenic
1175370284 20:58483720-58483742 GTCGTGCACATTTGAGGGCTGGG + Intronic
1176863953 21:14032041-14032063 TTGCTGCACAATTGTGGGTTGGG - Intergenic
1180539451 22:16429319-16429341 TTCCTCCACATATATTTGCTAGG - Intergenic
1203296236 22_KI270736v1_random:45352-45374 TTCCTGGAGATTTCTGGGCAAGG - Intergenic
949397338 3:3629030-3629052 GTCATGCACATTAATGTGCTGGG - Intergenic
951288395 3:20844519-20844541 TTACTGAACATTTATGTGCCAGG + Intergenic
954372383 3:50175621-50175643 GTCCTGCACACTCATGTGCTTGG + Intronic
954838812 3:53494248-53494270 TCCCCGCGCATTTCTGGGCTGGG - Intergenic
956039716 3:65133090-65133112 TTCCTTCAGATTTATGGTCAAGG - Intergenic
958467775 3:94479318-94479340 TTCTTTCTCATTTATGGACTAGG + Intergenic
961138747 3:124537411-124537433 TTCCAGCACATTTTTTGCCTTGG - Intronic
961451329 3:127003622-127003644 TCCCTGCAGACTTGTGGGCTCGG + Intronic
961553024 3:127679835-127679857 TCCCTGCGCATGTATGGGGTTGG - Intronic
961646728 3:128396784-128396806 TTGCTGCACCTTTACAGGCTAGG - Intronic
963323721 3:143837847-143837869 TTCCAGCATATTAATGGGCCCGG + Intronic
964269420 3:154939593-154939615 TTCTGTCACATTTGTGGGCTTGG - Intergenic
967804482 3:193703200-193703222 TTTCTGCTCATTTCTGGCCTCGG + Intergenic
968335789 3:197912333-197912355 GACCTACAAATTTATGGGCTGGG - Intronic
969839789 4:9872432-9872454 TTCCTGCACATTCACAGACTGGG - Intronic
974145290 4:57938744-57938766 TTCCTTGACACTTGTGGGCTAGG - Intergenic
976688736 4:87845471-87845493 TTACTGGACTTTTCTGGGCTTGG - Exonic
977115685 4:93023977-93023999 TTCCTGCTCAACAATGGGCTAGG - Intronic
977944912 4:102901493-102901515 TTCCTCCACATATATTTGCTAGG - Intronic
978306178 4:107330845-107330867 TTCCTGTCAATTTATGGGGTAGG + Intergenic
981424604 4:144588601-144588623 TTCATGGACATTTATGAGGTGGG - Intergenic
982216109 4:153083781-153083803 CTCCCCCACATTTATGAGCTTGG - Intergenic
983639532 4:169932086-169932108 CTACTTCACATTTATAGGCTGGG + Intergenic
984334243 4:178368108-178368130 TTCCTTGACATTTATGGGGTTGG - Intergenic
990468497 5:56091385-56091407 TTCCTGCACTTTGAGAGGCTGGG - Intergenic
991085992 5:62648677-62648699 TTGCTGCACACTGATGGGCAAGG + Intergenic
991895950 5:71397801-71397823 TTCCTGCACAGCTAAGTGCTTGG - Intergenic
995751283 5:115455782-115455804 TTTCTGCAGATGTGTGGGCTTGG + Intergenic
997032352 5:130145557-130145579 TGCCTGCACATTTGAGGTCTTGG - Intronic
997212068 5:132082740-132082762 TGCCTGCATATGTATGTGCTTGG + Intergenic
997607806 5:135188312-135188334 TTCTTTCACATTTTTGGGCAAGG - Intronic
998208909 5:140178938-140178960 TTCCTGGGGTTTTATGGGCTTGG + Intronic
998361007 5:141586989-141587011 TTCCTGTGCATTTATGGACATGG - Intronic
999032855 5:148313878-148313900 TTGCTGGGCATTTCTGGGCTAGG - Intronic
1002301418 5:178259437-178259459 TTCCTGCCCACTTCAGGGCTGGG - Intronic
1006652045 6:35559664-35559686 TTGCTAAACATTTATGGGGTAGG - Intergenic
1010148422 6:72700157-72700179 TTCCTGCCCATTTAAGAGTTGGG - Intronic
1010400231 6:75440378-75440400 TTCCTGCACAATCACAGGCTTGG - Intronic
1014470044 6:121802167-121802189 ATCCTGCAAATTTATAGGCGTGG + Intergenic
1014816594 6:125942557-125942579 TTACTGAACACTTATGTGCTAGG + Intergenic
1015511162 6:134039552-134039574 ATGCTGCAAATTTAGGGGCTAGG - Intronic
1018049784 6:159998850-159998872 TTGTTGCACATTCATGTGCTAGG + Intronic
1018697696 6:166403327-166403349 TTCATACACACTTATGGGGTAGG + Intergenic
1021311085 7:19097670-19097692 TTTTTGCACATATGTGGGCTGGG + Intronic
1023124390 7:36940644-36940666 TTCATGAACATCTATGTGCTAGG - Intronic
1025024753 7:55507089-55507111 TTTATCCACATGTATGGGCTGGG - Intronic
1026968129 7:74453377-74453399 TTCCTGCACATCTCAGGGGTGGG + Intergenic
1029432276 7:100539167-100539189 GTCCTGCACACTGATTGGCTAGG - Intergenic
1031167894 7:118252379-118252401 TTTCTGCACCTATATGAGCTTGG + Intergenic
1031937590 7:127751689-127751711 TTCCAGCAAATCTGTGGGCTGGG + Intronic
1032649308 7:133859894-133859916 TTCCTGCACTTTAAAGAGCTTGG - Intronic
1033137360 7:138796497-138796519 TTCCTGCGCATGAATGGGCCTGG - Intronic
1033596213 7:142860925-142860947 TTCCTGGATATATATGGCCTTGG - Intronic
1034113543 7:148562174-148562196 TTCTTCCACATATAAGGGCTTGG + Intergenic
1035736672 8:1892681-1892703 ATCTTGCACATATATGGGGTGGG + Intronic
1037800354 8:22031098-22031120 TTTCTGTACATTTCTTGGCTTGG + Intronic
1038398779 8:27267264-27267286 TTCCTGAGCATTTAGAGGCTAGG - Intergenic
1039070834 8:33648033-33648055 TTACAGCACATTTATGGGTCAGG + Intergenic
1039717521 8:40126335-40126357 TTCCTCCACATTTCTGGCTTAGG - Intergenic
1041827787 8:62117462-62117484 TGCCTGCACATTAAGGGGTTGGG + Intergenic
1045871333 8:106930504-106930526 TTCCTTCACATTTATGAGTCTGG + Intergenic
1046034474 8:108823863-108823885 TTACAGGATATTTATGGGCTTGG + Intergenic
1046232766 8:111379027-111379049 TATCTGTATATTTATGGGCTTGG + Intergenic
1046899641 8:119510004-119510026 TTTCTACACATTTTTGAGCTTGG - Intergenic
1048435688 8:134415068-134415090 TTGTTGCACATTTTTTGGCTAGG + Intergenic
1049725615 8:144144352-144144374 TTCCTGCACCTTGCTGGCCTGGG - Intergenic
1050693705 9:8256752-8256774 TTCCTGCAAATTACTGGTCTGGG + Intergenic
1051699171 9:19801283-19801305 TTCCTGCACAGCTATGTGCCTGG - Intergenic
1051783521 9:20716798-20716820 TGCCTGCACATTTGTGAACTTGG + Intronic
1054994023 9:71363928-71363950 TTTTTGTACATTTATGTGCTGGG - Intronic
1058060065 9:100485742-100485764 TTCTTGAGCATTTAGGGGCTTGG + Intronic
1058552835 9:106133966-106133988 TTTCTGGACATTAATGAGCTAGG - Intergenic
1059493790 9:114692494-114692516 TTCCTGCATATATTTGGGCAAGG - Intergenic
1185819398 X:3187019-3187041 CTCCTGCACATTTAGGGCTTCGG + Intergenic
1186352268 X:8751881-8751903 TACCTGCACATGCATGTGCTGGG - Intergenic
1186635089 X:11395133-11395155 TACATGCACATTTATGGACTTGG + Intronic
1189575785 X:42351782-42351804 TTTTTACACATTTATGGGGTAGG + Intergenic
1190021618 X:46883528-46883550 GTCCTTCTGATTTATGGGCTAGG - Intergenic
1193552494 X:82914270-82914292 TTTTTGCACATTTATGTCCTTGG + Intergenic
1197593431 X:128437885-128437907 TTCATGCAGATCTATGGGGTAGG + Intergenic
1202171372 Y:22048181-22048203 TTCCAGCACTTTTAGGGGCCAGG + Intergenic
1202219990 Y:22538191-22538213 TTCCAGCACTTTTAGGGGCCAGG - Intergenic
1202323126 Y:23657475-23657497 TTCCAGCACTTTTAGGGGCCAGG + Intergenic
1202547646 Y:26012579-26012601 TTCCAGCACTTTTAGGGGCCAGG - Intergenic