ID: 1147153311

View in Genome Browser
Species Human (GRCh38)
Location 17:38530974-38530996
Sequence GTTCCTGCACATTTATGGGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 5, 1: 0, 2: 0, 3: 3, 4: 110}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147153311_1147153321 27 Left 1147153311 17:38530974-38530996 CCAGCCCATAAATGTGCAGGAAC 0: 5
1: 0
2: 0
3: 3
4: 110
Right 1147153321 17:38531024-38531046 CTGGGCTTCACCCGAGCGGGTGG 0: 1
1: 1
2: 5
3: 5
4: 92
1147153311_1147153316 9 Left 1147153311 17:38530974-38530996 CCAGCCCATAAATGTGCAGGAAC 0: 5
1: 0
2: 0
3: 3
4: 110
Right 1147153316 17:38531006-38531028 AGAAAGATGCAAATCCCACTGGG 0: 5
1: 0
2: 1
3: 14
4: 203
1147153311_1147153322 28 Left 1147153311 17:38530974-38530996 CCAGCCCATAAATGTGCAGGAAC 0: 5
1: 0
2: 0
3: 3
4: 110
Right 1147153322 17:38531025-38531047 TGGGCTTCACCCGAGCGGGTGGG 0: 1
1: 1
2: 3
3: 12
4: 56
1147153311_1147153318 23 Left 1147153311 17:38530974-38530996 CCAGCCCATAAATGTGCAGGAAC 0: 5
1: 0
2: 0
3: 3
4: 110
Right 1147153318 17:38531020-38531042 CCCACTGGGCTTCACCCGAGCGG 0: 1
1: 3
2: 0
3: 9
4: 96
1147153311_1147153320 24 Left 1147153311 17:38530974-38530996 CCAGCCCATAAATGTGCAGGAAC 0: 5
1: 0
2: 0
3: 3
4: 110
Right 1147153320 17:38531021-38531043 CCACTGGGCTTCACCCGAGCGGG 0: 1
1: 2
2: 2
3: 8
4: 104
1147153311_1147153323 29 Left 1147153311 17:38530974-38530996 CCAGCCCATAAATGTGCAGGAAC 0: 5
1: 0
2: 0
3: 3
4: 110
Right 1147153323 17:38531026-38531048 GGGCTTCACCCGAGCGGGTGGGG 0: 1
1: 1
2: 9
3: 10
4: 87
1147153311_1147153315 8 Left 1147153311 17:38530974-38530996 CCAGCCCATAAATGTGCAGGAAC 0: 5
1: 0
2: 0
3: 3
4: 110
Right 1147153315 17:38531005-38531027 AAGAAAGATGCAAATCCCACTGG 0: 5
1: 0
2: 0
3: 25
4: 267

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147153311 Original CRISPR GTTCCTGCACATTTATGGGC TGG (reversed) Exonic
900340076 1:2184204-2184226 GGTCCTACACCTTTATGGTCAGG + Intronic
901482168 1:9532824-9532846 GATCATGAACATTTGTGGGCAGG + Intergenic
904119316 1:28186279-28186301 GATCTTGCACATTTTGGGGCCGG - Intronic
905322300 1:37126683-37126705 GTTCCTGAACCTTTCCGGGCAGG - Intergenic
906691764 1:47797502-47797524 GTACATGCACATTTGTGGTCAGG - Intronic
909152030 1:72018968-72018990 GTTCCTCCACATTTCTTGGTAGG - Intronic
910274722 1:85436825-85436847 GTTCTTGCACATTTCTGTCCAGG + Intronic
918065086 1:181095132-181095154 GATGCTGCCCACTTATGGGCAGG + Intergenic
919496398 1:198275269-198275291 GTATCTGAAAATTTATGGGCAGG - Intronic
922725997 1:227923349-227923371 GTTCCTGAACAGGGATGGGCAGG - Intronic
1067179078 10:43971489-43971511 GTTCCTGCACTTCTAGGGGTGGG - Intergenic
1070820711 10:79352450-79352472 ATTCGTGCACTTTTAGGGGCAGG + Intronic
1072194271 10:93102185-93102207 GGGCCTGGACATTTATGGGAAGG + Intergenic
1076939350 10:133591115-133591137 GTCCCTGCACCCTTGTGGGCAGG - Intergenic
1076976851 11:179182-179204 TTTCCTGCATATTTATGACCTGG - Intronic
1078635892 11:13049740-13049762 CTTCCTGCACATTTATTAGCTGG + Intergenic
1081383950 11:42448646-42448668 AATCTTGCACATTCATGGGCAGG + Intergenic
1084708316 11:70828981-70829003 GAGCCTGCACGTTTCTGGGCTGG + Intronic
1087917745 11:103830534-103830556 GTTCCTGAAAGTTTATGGGCTGG + Intergenic
1089993766 11:122885231-122885253 GTTCCTAGACCTATATGGGCTGG - Intronic
1090367319 11:126217682-126217704 GTTCCTGCACAGGAAAGGGCAGG - Intronic
1095053761 12:37577283-37577305 TTTCCTGCGCATTTCTGCGCTGG + Intergenic
1096124717 12:49110721-49110743 GTGCCTGCCCCTTTAAGGGCGGG - Exonic
1102628099 12:114252457-114252479 GTTTCTTCCCATTTCTGGGCTGG - Intergenic
1103848854 12:123918149-123918171 GTTTCTGTCCATTTCTGGGCTGG + Intronic
1106352254 13:28943546-28943568 GTTTCTGGACATTGTTGGGCAGG + Intronic
1106761455 13:32872660-32872682 GGTCCTCCACATTTACTGGCAGG + Intergenic
1109707396 13:66114383-66114405 GCTCCAACACATTTATGGGTTGG + Intergenic
1112807839 13:103182616-103182638 ATTCCTGCAAATATATGTGCTGG + Intergenic
1116471221 14:45287675-45287697 GTTTGTGCACATTTATAGGAGGG - Intergenic
1118176066 14:63441149-63441171 GTTCCTGCAGATTTTTATGCAGG + Intronic
1118374290 14:65163292-65163314 GTTGGTGCACATCTACGGGCAGG - Intergenic
1120510261 14:85404787-85404809 GTTCCTAGACATGTATGAGCTGG - Intergenic
1129149131 15:73676600-73676622 GTTCCTGTACATTAAGGGGTTGG + Intergenic
1131854555 15:96579572-96579594 GTTTCTGCACATATATTGGTAGG + Intergenic
1136690450 16:32024839-32024861 GTTCCTGCACATTTATGGGCCGG - Intergenic
1136791038 16:32968399-32968421 GTTCCTGCACATTTATGGGCTGG - Intergenic
1136878775 16:33885533-33885555 GTTCCTGCACATTTATGGGCTGG + Intergenic
1141435713 16:83998688-83998710 GTTCCTGCACACTTAAGTCCAGG + Intronic
1141843671 16:86592085-86592107 CTTTGTGCACATTTATGGGTGGG + Intergenic
1142176712 16:88648573-88648595 ATTTCTGCACATTTTTGGGGGGG + Intronic
1203093246 16_KI270728v1_random:1229860-1229882 GTTCCTGCACATTTATGGGCCGG - Intergenic
1144949850 17:18988273-18988295 CTTCCTGCACATGTGTGAGCGGG - Exonic
1147153311 17:38530974-38530996 GTTCCTGCACATTTATGGGCTGG - Exonic
1150287165 17:63960971-63960993 GTTTCAGGACATTTAGGGGCAGG - Intronic
1151109311 17:71656017-71656039 GTACCTGTCCATTTCTGGGCTGG - Intergenic
1153571080 18:6474153-6474175 GTACATGCACATATATGTGCAGG - Intergenic
1157035840 18:43972192-43972214 CTTGCTGCACATTAATGGTCTGG + Intergenic
1157727248 18:49974345-49974367 GGTCCTGGACATCTATGGGTAGG - Exonic
1159084067 18:63767680-63767702 TTTCCAGCTCATTTATGAGCTGG - Intronic
1164790060 19:30969799-30969821 GTTCCGGCAGAGTTATGGGTTGG + Intergenic
1165128698 19:33619088-33619110 GTTCCTGCCCGTCTTTGGGCTGG - Intergenic
1165523414 19:36331959-36331981 TTTCCTGCGCATTTTTGCGCTGG + Intergenic
1165573784 19:36796970-36796992 TTTCCTGCGCATTTCTGCGCTGG - Intergenic
1166997334 19:46725935-46725957 GATCCTGCACACTTGTGGGATGG - Intronic
925655463 2:6142950-6142972 GTTTCTGCACATTTTTAGTCTGG - Intergenic
927142503 2:20139910-20139932 GCTCCTTCAGATTTATGGTCAGG - Intergenic
927259651 2:21074591-21074613 GTTCCTGCACATTTGTTGAAAGG + Intergenic
928302329 2:30136868-30136890 CTTCCTGTACAGTAATGGGCAGG + Intergenic
929044121 2:37773959-37773981 GTTCCTGGAGATTTCTGGGCAGG - Intergenic
934939088 2:98486883-98486905 ATCACTGCACATTTGTGGGCTGG - Intronic
940791687 2:158035753-158035775 GTCCCTGCAGAATTATGTGCTGG - Intronic
946205014 2:218098814-218098836 GTTCCTGGACTTTTTTGGGTTGG + Intergenic
948355382 2:237373420-237373442 GTTCCTGAGCATTTATGATCAGG - Intronic
1171528501 20:25835072-25835094 ATTCCTGCGCATTTCTGCGCTGG - Intronic
1171548325 20:26020814-26020836 ATTCCTGCGCATTTCTGCGCTGG + Intergenic
1172641443 20:36442717-36442739 TTTCCTGCAGATTTTTGGACAGG + Exonic
1173060681 20:39657131-39657153 CTTCCAAAACATTTATGGGCTGG - Intergenic
1173583247 20:44162193-44162215 GCTCCTGGACATTTATTAGCAGG - Intronic
1176370238 21:6058000-6058022 GTTCCTGCACAGCGATGGCCTGG - Intergenic
1177396119 21:20538200-20538222 GTTCCTGCACAGATGGGGGCAGG - Intergenic
1178665401 21:34542256-34542278 GGTCCTCCACATTCAAGGGCAGG - Intronic
1179753281 21:43480541-43480563 GTTCCTGCACAGCGATGGCCTGG + Intergenic
1183723577 22:39576240-39576262 CATCCTGCACATTTTTGTGCTGG - Intronic
1184368991 22:44070736-44070758 TTTCCTGCACAGTGCTGGGCGGG + Intronic
949397339 3:3629031-3629053 GGTCATGCACATTAATGTGCTGG - Intergenic
955205318 3:56890562-56890584 GATCCTGCAGAATGATGGGCAGG + Intronic
962833404 3:139163972-139163994 TTCCCTCCACATTTATGAGCTGG + Intronic
964964991 3:162481534-162481556 GCTCCTGGACATTTCTGGACAGG - Intergenic
982215312 4:153078185-153078207 TTTCCTCCACATTTACTGGCTGG + Intergenic
983449376 4:167891426-167891448 GTTACTGCACATTAATGAGAAGG + Intergenic
983617869 4:169727815-169727837 GTTCCTGCACAGTTATGAAAGGG + Intergenic
988853882 5:35207438-35207460 GGTCCTGCATATTTATTGACGGG - Intronic
988999192 5:36743472-36743494 ATTTATGCACACTTATGGGCTGG - Intergenic
1001477435 5:172060552-172060574 GTGCCAGCACATTTGTGGTCTGG - Intronic
1008129877 6:47708801-47708823 GATTCTGCACAATTATGGCCAGG + Intronic
1009940927 6:70287100-70287122 GTGCATGCACATATATGGGTGGG + Intronic
1018347940 6:162922095-162922117 GTTGGTGCACATGTGTGGGCCGG + Intronic
1018695285 6:166386180-166386202 GTTTCTGAACTTTGATGGGCAGG - Intergenic
1023215088 7:37853629-37853651 TTTCTTTCACCTTTATGGGCAGG - Intronic
1025284665 7:57651909-57651931 TTTCCTGGACATTGATGGACAGG - Intergenic
1026408464 7:70093470-70093492 CTTCCTTCACTTTTATGGACAGG + Intronic
1026579918 7:71606739-71606761 GTTCCTGCCCACATATGTGCTGG + Intronic
1030456135 7:109776317-109776339 GGTCCTGCACATTTTTGTGGAGG - Intergenic
1031937589 7:127751688-127751710 GTTCCAGCAAATCTGTGGGCTGG + Intronic
1034028537 7:147734641-147734663 GGTCCTGCACATTTTTTGGTTGG + Intronic
1034110438 7:148532482-148532504 GGTCCTGGACATTTTTTGGCTGG - Intergenic
1034734371 7:153414468-153414490 GTTTCATCACATTTATGGACTGG + Intergenic
1036094653 8:5710477-5710499 GCTCCTTCACTTTGATGGGCCGG - Intergenic
1036211827 8:6847708-6847730 GGTCCTGCACTTTTTTTGGCTGG + Intergenic
1036518772 8:9470847-9470869 CTTCCTGCACATTTATCAGTTGG - Intergenic
1037140245 8:15510691-15510713 GTTCCTGAAAATTTAAGAGCGGG + Intronic
1039389201 8:37163422-37163444 GTACCTGAACATTTATGAGTTGG - Intergenic
1040473486 8:47756578-47756600 GGTCCTGCACTTTTTTTGGCTGG + Intergenic
1045472817 8:102527520-102527542 GCTCCTGCATGTTTATGGGAGGG + Intergenic
1049075562 8:140393401-140393423 CTACCTGTACATTTATGGGTTGG - Intronic
1049154173 8:141056828-141056850 GTCCCTGCACATTTCTGGTTAGG - Intergenic
1053796468 9:41731233-41731255 TTTCCTGCGCATTTCTGCGCTGG - Intergenic
1054148710 9:61583595-61583617 TTTCCTGCGCATTTCTGCGCTGG + Intergenic
1054184874 9:61943309-61943331 TTTCCTGCGCATTTCTGCGCTGG - Intergenic
1054468471 9:65514724-65514746 TTTCCTGCGCATTTCTGCGCTGG + Intergenic
1054653633 9:67645195-67645217 TTTCCTGCGCATTTCTGCGCTGG + Intergenic
1060206729 9:121686699-121686721 GTTCCTGCCCATTTACAGACAGG - Intronic
1187644175 X:21328585-21328607 GTGCCAGCACATTTGTGTGCAGG + Intergenic
1193068493 X:77282512-77282534 GTTCCTGGACTTTTTTGGTCTGG - Intergenic
1194344197 X:92742899-92742921 CTACCTGCACATTTATGGTTTGG + Intergenic
1196671655 X:118374637-118374659 GTTCCAGCACATTTAACGACAGG - Intronic
1200652544 Y:5859551-5859573 CTACCTGCACATTTATGGTTTGG + Intergenic